Incidental Mutation 'R7411:Rhbdl2'
ID 575060
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Name rhomboid like 2
Synonyms
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 123681667-123723697 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123723435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 280 (A280T)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
AlphaFold A2AGA4
Predicted Effect possibly damaging
Transcript: ENSMUST00000053202
AA Change: A280T

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: A280T

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106204
AA Change: A280T

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: A280T

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137546
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123,723,450 (GRCm39) missense probably benign
IGL02111:Rhbdl2 APN 4 123,716,630 (GRCm39) missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123,716,610 (GRCm39) missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123,723,463 (GRCm39) nonsense probably null
R0039:Rhbdl2 UTSW 4 123,703,822 (GRCm39) missense probably benign 0.02
R1292:Rhbdl2 UTSW 4 123,723,435 (GRCm39) missense possibly damaging 0.69
R2024:Rhbdl2 UTSW 4 123,720,665 (GRCm39) missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R4364:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4366:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123,703,880 (GRCm39) missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123,720,694 (GRCm39) critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123,711,710 (GRCm39) nonsense probably null
R5303:Rhbdl2 UTSW 4 123,704,014 (GRCm39) intron probably benign
R5951:Rhbdl2 UTSW 4 123,708,120 (GRCm39) missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123,703,908 (GRCm39) missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123,708,049 (GRCm39) missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123,711,659 (GRCm39) missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123,711,658 (GRCm39) missense probably benign 0.01
R7718:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R8152:Rhbdl2 UTSW 4 123,718,711 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATTTGCGCTGGAGTAGGAGATC -3'
(R):5'- TTGTAAGCTCAGTCGCTGTCC -3'

Sequencing Primer
(F):5'- GTAGGAGATCCACAGCTAAAATATAC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On 2019-10-07