Incidental Mutation 'R7411:Speer1e'
ID 575063
Institutional Source Beutler Lab
Gene Symbol Speer1e
Ensembl Gene ENSMUSG00000095918
Gene Name spermatogenesis associated glutamate (E)-rich protein 1E
Synonyms Gm5861
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R7411 (G1)
Quality Score 85.0076
Status Not validated
Chromosome 5
Chromosomal Location 11233039-11237777 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 11233116 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168407] [ENSMUST00000171093]
AlphaFold L7N474
Predicted Effect probably benign
Transcript: ENSMUST00000168407
SMART Domains Protein: ENSMUSP00000127608
Gene: ENSMUSG00000095918

DomainStartEndE-ValueType
Pfam:Takusan 2 90 1.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171093
SMART Domains Protein: ENSMUSP00000132429
Gene: ENSMUSG00000095918

DomainStartEndE-ValueType
Pfam:Takusan 29 115 2.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Speer1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03197:Speer1e APN 5 11,233,080 (GRCm39) missense probably damaging 0.96
R0942:Speer1e UTSW 5 11,236,488 (GRCm39) missense probably benign 0.06
R1731:Speer1e UTSW 5 11,233,080 (GRCm39) missense probably damaging 0.96
R4751:Speer1e UTSW 5 11,236,458 (GRCm39) missense probably damaging 0.99
R4990:Speer1e UTSW 5 11,236,381 (GRCm39) missense probably damaging 0.96
R7222:Speer1e UTSW 5 11,233,080 (GRCm39) missense probably damaging 0.96
R7790:Speer1e UTSW 5 11,234,185 (GRCm39) missense probably benign
R8725:Speer1e UTSW 5 11,236,408 (GRCm39) missense probably benign 0.15
R9215:Speer1e UTSW 5 11,236,449 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGATGTCACCAGTGTTGTAGCAAC -3'
(R):5'- GCATAACAGTTTTGGCCTTGC -3'

Sequencing Primer
(F):5'- GCTCATATAGGATTCTCACTCAGTG -3'
(R):5'- GCCTTGCCAGCTCCTGC -3'
Posted On 2019-10-07