Incidental Mutation 'R7411:Sema3a'
ID 575064
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms Semad, collapsin-1, SemD, sema III, semaphorin III
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 13175381-13652533 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 13566230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 171 (Y171*)
Ref Sequence ENSEMBL: ENSMUSP00000030714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
AlphaFold no structure available at present
PDB Structure Structure of the Semaphorin 3A Receptor-Binding Module [X-RAY DIFFRACTION]
Mouse Semaphorin 3A, domains Sema-PSI-IG [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030714
AA Change: Y171*
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883
AA Change: Y171*

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095012
AA Change: Y171*
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883
AA Change: Y171*

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137798
AA Change: Y171*
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883
AA Change: Y171*

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13,523,433 (GRCm39) missense probably damaging 1.00
IGL01783:Sema3a APN 5 13,611,767 (GRCm39) missense probably damaging 1.00
IGL02423:Sema3a APN 5 13,615,776 (GRCm39) missense probably damaging 1.00
IGL02728:Sema3a APN 5 13,615,881 (GRCm39) missense probably damaging 1.00
IGL02739:Sema3a APN 5 13,501,128 (GRCm39) missense probably damaging 1.00
IGL02987:Sema3a APN 5 13,615,863 (GRCm39) missense probably damaging 1.00
IGL03106:Sema3a APN 5 13,649,456 (GRCm39) missense probably damaging 1.00
R0055:Sema3a UTSW 5 13,450,004 (GRCm39) missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13,607,268 (GRCm39) missense probably damaging 0.99
R0684:Sema3a UTSW 5 13,606,494 (GRCm39) critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R1204:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably benign
R1221:Sema3a UTSW 5 13,566,190 (GRCm39) missense probably benign
R1484:Sema3a UTSW 5 13,523,407 (GRCm39) missense probably damaging 1.00
R1663:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R2079:Sema3a UTSW 5 13,501,098 (GRCm39) missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13,523,364 (GRCm39) critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13,620,125 (GRCm39) missense probably damaging 1.00
R4867:Sema3a UTSW 5 13,501,208 (GRCm39) missense probably benign 0.05
R4904:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
R5107:Sema3a UTSW 5 13,627,572 (GRCm39) nonsense probably null
R5327:Sema3a UTSW 5 13,649,357 (GRCm39) missense probably benign 0.25
R5343:Sema3a UTSW 5 13,523,373 (GRCm39) missense probably damaging 1.00
R5430:Sema3a UTSW 5 13,615,730 (GRCm39) missense probably damaging 0.97
R5604:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R5774:Sema3a UTSW 5 13,573,131 (GRCm39) missense probably damaging 1.00
R6057:Sema3a UTSW 5 13,615,832 (GRCm39) missense probably damaging 1.00
R6110:Sema3a UTSW 5 13,630,969 (GRCm39) missense probably damaging 1.00
R6132:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably null
R6310:Sema3a UTSW 5 13,606,986 (GRCm39) missense probably damaging 1.00
R6754:Sema3a UTSW 5 13,649,243 (GRCm39) missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13,647,584 (GRCm39) missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13,505,511 (GRCm39) missense possibly damaging 0.88
R7501:Sema3a UTSW 5 13,607,008 (GRCm39) missense probably damaging 1.00
R7514:Sema3a UTSW 5 13,573,093 (GRCm39) missense probably benign 0.03
R7531:Sema3a UTSW 5 13,615,805 (GRCm39) missense probably damaging 1.00
R7538:Sema3a UTSW 5 13,611,787 (GRCm39) missense probably benign 0.42
R7970:Sema3a UTSW 5 13,649,375 (GRCm39) missense possibly damaging 0.93
R8121:Sema3a UTSW 5 13,649,215 (GRCm39) missense probably damaging 1.00
R8283:Sema3a UTSW 5 13,450,030 (GRCm39) missense probably damaging 0.98
R8434:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R8918:Sema3a UTSW 5 13,573,099 (GRCm39) missense probably damaging 1.00
R9500:Sema3a UTSW 5 13,615,854 (GRCm39) missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAATTAACGTACTCCATACTGG -3'
(R):5'- CTTAGGTTGAGTAGGGCAAACAAC -3'

Sequencing Primer
(F):5'- ACTGGATGTGAATAATCAACTTCTC -3'
(R):5'- TTGAGTAGGGCAAACAACAGTCAAC -3'
Posted On 2019-10-07