Incidental Mutation 'R7411:Sema3a'
ID575064
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
SynonymsSemad, semaphorin III, SemD, sema III, collapsin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location13125414-13602565 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 13516263 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 171 (Y171*)
Ref Sequence ENSEMBL: ENSMUSP00000030714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
PDB Structure
Structure of the Semaphorin 3A Receptor-Binding Module [X-RAY DIFFRACTION]
Mouse Semaphorin 3A, domains Sema-PSI-IG [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030714
AA Change: Y171*
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883
AA Change: Y171*

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095012
AA Change: Y171*
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883
AA Change: Y171*

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137798
AA Change: Y171*
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883
AA Change: Y171*

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13473466 missense probably damaging 1.00
IGL01783:Sema3a APN 5 13561800 missense probably damaging 1.00
IGL02423:Sema3a APN 5 13565809 missense probably damaging 1.00
IGL02728:Sema3a APN 5 13565914 missense probably damaging 1.00
IGL02739:Sema3a APN 5 13451161 missense probably damaging 1.00
IGL02987:Sema3a APN 5 13565896 missense probably damaging 1.00
IGL03106:Sema3a APN 5 13599488 missense probably damaging 1.00
R0055:Sema3a UTSW 5 13400037 missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13557301 missense probably damaging 0.99
R0684:Sema3a UTSW 5 13556527 critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13557125 critical splice donor site probably null
R1204:Sema3a UTSW 5 13523175 critical splice donor site probably benign
R1221:Sema3a UTSW 5 13516223 missense probably benign
R1484:Sema3a UTSW 5 13473440 missense probably damaging 1.00
R1663:Sema3a UTSW 5 13557125 critical splice donor site probably null
R2079:Sema3a UTSW 5 13451131 missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13473397 critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13570157 missense probably damaging 1.00
R4867:Sema3a UTSW 5 13451241 missense probably benign 0.05
R4904:Sema3a UTSW 5 13581098 missense probably damaging 1.00
R5107:Sema3a UTSW 5 13577604 nonsense probably null
R5327:Sema3a UTSW 5 13599389 missense probably benign 0.25
R5343:Sema3a UTSW 5 13473406 missense probably damaging 1.00
R5430:Sema3a UTSW 5 13565763 missense probably damaging 0.97
R5604:Sema3a UTSW 5 13473520 critical splice donor site probably null
R5774:Sema3a UTSW 5 13523164 missense probably damaging 1.00
R6057:Sema3a UTSW 5 13565865 missense probably damaging 1.00
R6110:Sema3a UTSW 5 13581001 missense probably damaging 1.00
R6132:Sema3a UTSW 5 13523175 critical splice donor site probably null
R6310:Sema3a UTSW 5 13557019 missense probably damaging 1.00
R6754:Sema3a UTSW 5 13599275 missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13597616 missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13455544 missense possibly damaging 0.88
R7501:Sema3a UTSW 5 13557041 missense probably damaging 1.00
R7514:Sema3a UTSW 5 13523126 missense probably benign 0.03
R7531:Sema3a UTSW 5 13565838 missense probably damaging 1.00
R7538:Sema3a UTSW 5 13561820 missense probably benign 0.42
X0064:Sema3a UTSW 5 13581098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAATTAACGTACTCCATACTGG -3'
(R):5'- CTTAGGTTGAGTAGGGCAAACAAC -3'

Sequencing Primer
(F):5'- ACTGGATGTGAATAATCAACTTCTC -3'
(R):5'- TTGAGTAGGGCAAACAACAGTCAAC -3'
Posted On2019-10-07