Incidental Mutation 'R7411:Kdm5a'
ID575073
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120426815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1127 (V1127E)
Ref Sequence ENSEMBL: ENSMUSP00000005108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108]
Predicted Effect probably damaging
Transcript: ENSMUST00000005108
AA Change: V1127E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: V1127E

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
Calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7521:Kdm5a UTSW 6 120432187 nonsense probably null
R7570:Kdm5a UTSW 6 120427842 missense probably damaging 0.99
R7647:Kdm5a UTSW 6 120427786 missense probably benign 0.01
R7704:Kdm5a UTSW 6 120427064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGAGAAATGTTTGTGTGCTAAC -3'
(R):5'- ATCTTTAGCCTGCCAGCTG -3'

Sequencing Primer
(F):5'- CACACGTTTTAGGAAATTGCCACTG -3'
(R):5'- ACAGCTGTTATGGAACCAGTC -3'
Posted On2019-10-07