Incidental Mutation 'R7411:Med25'
ID 575078
Institutional Source Beutler Lab
Gene Symbol Med25
Ensembl Gene ENSMUSG00000002968
Gene Name mediator complex subunit 25
Synonyms 2610529E18Rik, 2610034E13Rik, ESTM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 44876765-44892712 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44878243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 730 (W730R)
Ref Sequence ENSEMBL: ENSMUSP00000146405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003049] [ENSMUST00000207278] [ENSMUST00000207654] [ENSMUST00000207848] [ENSMUST00000208253] [ENSMUST00000208551]
AlphaFold Q8VCB2
Predicted Effect probably benign
Transcript: ENSMUST00000003049
SMART Domains Protein: ENSMUSP00000003049
Gene: ENSMUSG00000002968

DomainStartEndE-ValueType
VWA 15 178 6.55e0 SMART
low complexity region 193 211 N/A INTRINSIC
Pfam:Med25_SD1 228 383 5.8e-55 PFAM
Pfam:Med25 396 546 3.9e-64 PFAM
low complexity region 577 592 N/A INTRINSIC
low complexity region 596 632 N/A INTRINSIC
Pfam:Med25_NR-box 657 745 5.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207278
Predicted Effect probably benign
Transcript: ENSMUST00000207654
Predicted Effect probably benign
Transcript: ENSMUST00000207848
Predicted Effect probably damaging
Transcript: ENSMUST00000208253
AA Change: W730R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208551
Predicted Effect probably benign
Transcript: ENSMUST00000209191
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the transcriptional coactivator complex termed the Mediator complex. This complex is required for transcription of most RNA polymerase II-dependent genes. The encoded protein plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Med25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Med25 APN 7 44882831 missense possibly damaging 0.86
IGL02963:Med25 APN 7 44892256 missense probably damaging 1.00
R0102:Med25 UTSW 7 44885480 missense possibly damaging 0.92
R0167:Med25 UTSW 7 44883097 critical splice donor site probably null
R0302:Med25 UTSW 7 44880558 unclassified probably benign
R0497:Med25 UTSW 7 44892100 missense probably damaging 1.00
R0511:Med25 UTSW 7 44885078 critical splice donor site probably null
R1054:Med25 UTSW 7 44880380 missense probably benign 0.03
R1914:Med25 UTSW 7 44884622 missense probably benign 0.01
R2305:Med25 UTSW 7 44885890 missense possibly damaging 0.91
R2360:Med25 UTSW 7 44885142 missense probably damaging 1.00
R3436:Med25 UTSW 7 44885890 missense possibly damaging 0.91
R4736:Med25 UTSW 7 44892288 missense probably damaging 1.00
R4807:Med25 UTSW 7 44884619 missense probably benign 0.23
R4945:Med25 UTSW 7 44883102 missense possibly damaging 0.93
R5494:Med25 UTSW 7 44885801 missense probably damaging 1.00
R7037:Med25 UTSW 7 44882782 missense probably damaging 1.00
R7078:Med25 UTSW 7 44884901 missense probably damaging 1.00
R7542:Med25 UTSW 7 44891791 missense probably damaging 0.96
R7883:Med25 UTSW 7 44891808 missense possibly damaging 0.77
R9541:Med25 UTSW 7 44891843 missense possibly damaging 0.77
R9696:Med25 UTSW 7 44880100 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCATGGCTATTCCTGGCTC -3'
(R):5'- TTAATGTGCAGGTGACCCAC -3'

Sequencing Primer
(F):5'- AGGGCCCTTTTCAGTTCCTG -3'
(R):5'- TAGCTGTAACGCTCCAGTGAG -3'
Posted On 2019-10-07