Incidental Mutation 'R7411:Abcc8'
ID 575079
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene Name ATP-binding cassette, sub-family C member 8
Synonyms SUR1, Sur, D930031B21Rik
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.500) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45753952-45829441 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 45815341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
AlphaFold B2RUS7
Predicted Effect probably null
Transcript: ENSMUST00000033123
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 45,754,088 (GRCm39) missense probably benign
IGL01457:Abcc8 APN 7 45,784,917 (GRCm39) missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 45,764,477 (GRCm39) missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 45,801,091 (GRCm39) missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 45,774,273 (GRCm39) missense probably benign 0.01
IGL01912:Abcc8 APN 7 45,769,934 (GRCm39) missense probably damaging 1.00
IGL02218:Abcc8 APN 7 45,769,860 (GRCm39) missense probably benign 0.00
IGL02326:Abcc8 APN 7 45,772,281 (GRCm39) critical splice donor site probably null
IGL02403:Abcc8 APN 7 45,755,227 (GRCm39) splice site probably null
IGL02411:Abcc8 APN 7 45,756,431 (GRCm39) missense probably damaging 1.00
IGL02653:Abcc8 APN 7 45,765,191 (GRCm39) splice site probably benign
IGL02706:Abcc8 APN 7 45,816,345 (GRCm39) missense probably benign 0.08
R0295:Abcc8 UTSW 7 45,767,478 (GRCm39) missense probably benign
R0381:Abcc8 UTSW 7 45,757,858 (GRCm39) missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 45,771,597 (GRCm39) missense probably damaging 0.98
R0408:Abcc8 UTSW 7 45,756,457 (GRCm39) missense probably damaging 0.99
R0496:Abcc8 UTSW 7 45,758,244 (GRCm39) missense probably damaging 1.00
R1126:Abcc8 UTSW 7 45,759,062 (GRCm39) missense probably damaging 0.99
R1323:Abcc8 UTSW 7 45,766,786 (GRCm39) missense probably benign 0.07
R1323:Abcc8 UTSW 7 45,766,786 (GRCm39) missense probably benign 0.07
R1352:Abcc8 UTSW 7 45,784,892 (GRCm39) splice site probably benign
R1368:Abcc8 UTSW 7 45,772,284 (GRCm39) missense probably damaging 1.00
R1437:Abcc8 UTSW 7 45,829,237 (GRCm39) missense probably damaging 1.00
R1463:Abcc8 UTSW 7 45,803,936 (GRCm39) missense probably benign 0.12
R1689:Abcc8 UTSW 7 45,769,827 (GRCm39) missense probably benign 0.16
R1717:Abcc8 UTSW 7 45,765,239 (GRCm39) missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 45,769,903 (GRCm39) missense probably benign 0.02
R1848:Abcc8 UTSW 7 45,816,326 (GRCm39) missense probably benign
R1870:Abcc8 UTSW 7 45,773,339 (GRCm39) missense probably benign 0.05
R1938:Abcc8 UTSW 7 45,824,795 (GRCm39) missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 45,766,847 (GRCm39) splice site probably null
R1994:Abcc8 UTSW 7 45,806,543 (GRCm39) missense probably benign 0.02
R2511:Abcc8 UTSW 7 45,800,204 (GRCm39) missense probably damaging 1.00
R3840:Abcc8 UTSW 7 45,757,524 (GRCm39) missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 45,754,051 (GRCm39) missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 45,785,618 (GRCm39) missense probably benign 0.09
R4463:Abcc8 UTSW 7 45,756,005 (GRCm39) splice site probably null
R4761:Abcc8 UTSW 7 45,762,499 (GRCm39) missense probably damaging 1.00
R4816:Abcc8 UTSW 7 45,754,131 (GRCm39) missense probably benign 0.01
R4841:Abcc8 UTSW 7 45,800,252 (GRCm39) missense probably damaging 1.00
R4842:Abcc8 UTSW 7 45,800,252 (GRCm39) missense probably damaging 1.00
R4870:Abcc8 UTSW 7 45,756,683 (GRCm39) nonsense probably null
R4969:Abcc8 UTSW 7 45,754,943 (GRCm39) missense probably benign 0.02
R4975:Abcc8 UTSW 7 45,800,291 (GRCm39) missense probably damaging 0.98
R5258:Abcc8 UTSW 7 45,806,572 (GRCm39) missense probably benign 0.17
R5258:Abcc8 UTSW 7 45,757,811 (GRCm39) missense probably benign
R5502:Abcc8 UTSW 7 45,758,262 (GRCm39) missense probably benign 0.00
R5518:Abcc8 UTSW 7 45,769,873 (GRCm39) missense probably benign
R5660:Abcc8 UTSW 7 45,757,828 (GRCm39) missense probably benign 0.15
R5902:Abcc8 UTSW 7 45,764,463 (GRCm39) missense probably benign
R5907:Abcc8 UTSW 7 45,773,330 (GRCm39) missense probably benign 0.01
R6023:Abcc8 UTSW 7 45,757,843 (GRCm39) missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 45,816,424 (GRCm39) missense probably benign
R6078:Abcc8 UTSW 7 45,755,268 (GRCm39) missense probably benign 0.01
R6079:Abcc8 UTSW 7 45,755,268 (GRCm39) missense probably benign 0.01
R6103:Abcc8 UTSW 7 45,768,445 (GRCm39) missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 45,824,874 (GRCm39) missense probably benign 0.01
R6511:Abcc8 UTSW 7 45,800,285 (GRCm39) missense possibly damaging 0.82
R7046:Abcc8 UTSW 7 45,772,364 (GRCm39) missense probably damaging 1.00
R7230:Abcc8 UTSW 7 45,766,812 (GRCm39) missense probably benign
R7287:Abcc8 UTSW 7 45,762,534 (GRCm39) missense probably damaging 1.00
R7292:Abcc8 UTSW 7 45,784,950 (GRCm39) missense probably benign
R7299:Abcc8 UTSW 7 45,754,922 (GRCm39) missense possibly damaging 0.62
R7693:Abcc8 UTSW 7 45,827,968 (GRCm39) missense probably damaging 0.99
R7704:Abcc8 UTSW 7 45,756,068 (GRCm39) missense probably damaging 0.98
R7911:Abcc8 UTSW 7 45,803,860 (GRCm39) missense probably damaging 1.00
R7947:Abcc8 UTSW 7 45,754,886 (GRCm39) critical splice donor site probably null
R8089:Abcc8 UTSW 7 45,757,780 (GRCm39) missense probably benign 0.00
R8120:Abcc8 UTSW 7 45,786,108 (GRCm39) missense probably benign 0.01
R8394:Abcc8 UTSW 7 45,803,977 (GRCm39) missense probably benign 0.03
R8731:Abcc8 UTSW 7 45,803,986 (GRCm39) missense probably damaging 0.98
R8848:Abcc8 UTSW 7 45,766,769 (GRCm39) missense possibly damaging 0.69
R8938:Abcc8 UTSW 7 45,816,418 (GRCm39) missense
R9246:Abcc8 UTSW 7 45,774,289 (GRCm39) missense probably benign 0.00
R9293:Abcc8 UTSW 7 45,756,092 (GRCm39) missense probably benign 0.00
R9476:Abcc8 UTSW 7 45,819,270 (GRCm39) missense possibly damaging 0.92
R9516:Abcc8 UTSW 7 45,787,429 (GRCm39) missense probably benign 0.30
R9541:Abcc8 UTSW 7 45,801,079 (GRCm39) missense probably benign 0.04
R9701:Abcc8 UTSW 7 45,786,054 (GRCm39) missense probably benign
R9802:Abcc8 UTSW 7 45,786,054 (GRCm39) missense probably benign
U15987:Abcc8 UTSW 7 45,755,268 (GRCm39) missense probably benign 0.01
Z1088:Abcc8 UTSW 7 45,787,489 (GRCm39) missense probably benign
Z1176:Abcc8 UTSW 7 45,756,389 (GRCm39) missense possibly damaging 0.76
Z1177:Abcc8 UTSW 7 45,803,933 (GRCm39) missense probably benign 0.00
Z1177:Abcc8 UTSW 7 45,772,309 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCACCAAGAATCTCTCG -3'
(R):5'- TCTTGGCAGCGGAAAGACAC -3'

Sequencing Primer
(F):5'- ACCAAGAATCTCTCGGGGGC -3'
(R):5'- GACACGCAGAGCCAGCAG -3'
Posted On 2019-10-07