Incidental Mutation 'R7411:Alpk3'
ID575080
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Namealpha-kinase 3
SynonymsMidori
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location81057600-81105612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81092852 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 806 (T806S)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
Predicted Effect probably benign
Transcript: ENSMUST00000107348
AA Change: T806S

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: T806S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8246:Alpk3 UTSW 7 81092776 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8457:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8775:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8794:Alpk3 UTSW 7 81057655 missense unknown
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTTCGAAACCCAATCAGAGC -3'
(R):5'- CCTGACTCAAGCCAGTTGAATG -3'

Sequencing Primer
(F):5'- CCAATCAGAGCAGTTGTCCATGG -3'
(R):5'- AGTTGAATGCCCACCAGAG -3'
Posted On2019-10-07