Incidental Mutation 'R7411:Abcc12'
ID 575084
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms 4930467B22Rik, MRP9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 86482260-86580686 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 86560850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 122 (R122L)
Ref Sequence ENSEMBL: ENSMUSP00000079014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000152438] [ENSMUST00000156610]
AlphaFold Q80WJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000080115
AA Change: R122L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129898
AA Change: R122L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131423
AA Change: R122L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131806
AA Change: R122L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152438
AA Change: R122L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114582
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156610
AA Change: R122L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 86534693 missense probably benign 0.45
IGL01504:Abcc12 APN 8 86557602 missense probably damaging 1.00
IGL01593:Abcc12 APN 8 86557650 missense probably damaging 1.00
IGL02164:Abcc12 APN 8 86527404 missense probably damaging 1.00
IGL02173:Abcc12 APN 8 86566442 missense probably damaging 1.00
IGL02175:Abcc12 APN 8 86535013 splice site probably null
IGL02405:Abcc12 APN 8 86558153 missense probably damaging 0.98
IGL02620:Abcc12 APN 8 86505314 splice site probably null
IGL02635:Abcc12 APN 8 86509682 splice site probably benign
IGL03241:Abcc12 APN 8 86509807 missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 86505246 missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0116:Abcc12 UTSW 8 86534998 missense probably benign 0.00
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0132:Abcc12 UTSW 8 86531568 missense probably benign
R0308:Abcc12 UTSW 8 86557752 splice site probably benign
R0589:Abcc12 UTSW 8 86560472 missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 86557693 missense probably damaging 1.00
R1564:Abcc12 UTSW 8 86517486 missense probably benign 0.10
R1740:Abcc12 UTSW 8 86505497 nonsense probably null
R1740:Abcc12 UTSW 8 86509771 missense possibly damaging 0.78
R1970:Abcc12 UTSW 8 86527281 missense probably benign 0.27
R2017:Abcc12 UTSW 8 86563988 missense probably damaging 1.00
R2026:Abcc12 UTSW 8 86558233 missense probably benign 0.30
R2402:Abcc12 UTSW 8 86509141 missense probably damaging 1.00
R3085:Abcc12 UTSW 8 86543907 splice site probably benign
R3115:Abcc12 UTSW 8 86540024 critical splice donor site probably null
R3176:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3276:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3847:Abcc12 UTSW 8 86553391 missense probably benign 0.05
R3911:Abcc12 UTSW 8 86528419 splice site probably benign
R4031:Abcc12 UTSW 8 86517448 missense probably damaging 1.00
R4297:Abcc12 UTSW 8 86531525 splice site probably null
R4298:Abcc12 UTSW 8 86531525 splice site probably null
R4299:Abcc12 UTSW 8 86531525 splice site probably null
R4688:Abcc12 UTSW 8 86548694 missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 86560842 missense probably damaging 1.00
R4863:Abcc12 UTSW 8 86538376 missense probably damaging 1.00
R4892:Abcc12 UTSW 8 86509802 missense probably benign 0.28
R5288:Abcc12 UTSW 8 86566539 missense probably damaging 1.00
R5303:Abcc12 UTSW 8 86509786 missense probably benign 0.15
R5332:Abcc12 UTSW 8 86524830 splice site probably null
R5386:Abcc12 UTSW 8 86517489 missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 86509844 missense probably benign 0.03
R5900:Abcc12 UTSW 8 86566520 missense possibly damaging 0.90
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6291:Abcc12 UTSW 8 86566544 missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 86509089
R6677:Abcc12 UTSW 8 86534752 missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 86560857 missense possibly damaging 0.94
R7619:Abcc12 UTSW 8 86566553 missense probably damaging 1.00
R7808:Abcc12 UTSW 8 86507939 missense probably benign 0.03
R7828:Abcc12 UTSW 8 86528275 missense probably benign 0.08
R7834:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7834:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
R7939:Abcc12 UTSW 8 86548804 missense probably damaging 1.00
R7989:Abcc12 UTSW 8 86505479 missense probably benign 0.02
R8290:Abcc12 UTSW 8 86512282 missense probably damaging 0.99
R8681:Abcc12 UTSW 8 86505279 missense possibly damaging 0.74
R8795:Abcc12 UTSW 8 86531584 missense possibly damaging 0.87
R8811:Abcc12 UTSW 8 86553394 missense probably damaging 1.00
R8939:Abcc12 UTSW 8 86517318 missense probably damaging 1.00
R8940:Abcc12 UTSW 8 86560811 missense probably benign 0.45
R9711:Abcc12 UTSW 8 86548759 missense probably damaging 1.00
X0027:Abcc12 UTSW 8 86553291 missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 86560279 splice site probably null
Z1176:Abcc12 UTSW 8 86550601 missense probably damaging 1.00
Z1177:Abcc12 UTSW 8 86527384 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCTGCACTTGAGAAGAATTGG -3'
(R):5'- CTTTGCAGGAGTTTGCCCAC -3'

Sequencing Primer
(F):5'- GGGTTTATGGAAATTCACCCTCAAGG -3'
(R):5'- CCACCAAAGCAATTGTAGCTGATTG -3'
Posted On 2019-10-07