Incidental Mutation 'R7411:Abcc12'
ID 575084
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene Name ATP-binding cassette, sub-family C member 12
Synonyms MRP9, 4930467B22Rik
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 87231197-87307317 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 87287479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 122 (R122L)
Ref Sequence ENSEMBL: ENSMUSP00000079014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000152438] [ENSMUST00000156610]
AlphaFold Q80WJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000080115
AA Change: R122L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129898
AA Change: R122L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131423
AA Change: R122L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131806
AA Change: R122L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152438
AA Change: R122L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114582
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156610
AA Change: R122L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872
AA Change: R122L

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 87,261,322 (GRCm39) missense probably benign 0.45
IGL01504:Abcc12 APN 8 87,284,231 (GRCm39) missense probably damaging 1.00
IGL01593:Abcc12 APN 8 87,284,279 (GRCm39) missense probably damaging 1.00
IGL02164:Abcc12 APN 8 87,254,033 (GRCm39) missense probably damaging 1.00
IGL02173:Abcc12 APN 8 87,293,071 (GRCm39) missense probably damaging 1.00
IGL02175:Abcc12 APN 8 87,261,642 (GRCm39) splice site probably null
IGL02405:Abcc12 APN 8 87,284,782 (GRCm39) missense probably damaging 0.98
IGL02620:Abcc12 APN 8 87,231,943 (GRCm39) splice site probably null
IGL02635:Abcc12 APN 8 87,236,311 (GRCm39) splice site probably benign
IGL03241:Abcc12 APN 8 87,236,436 (GRCm39) missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 87,231,875 (GRCm39) missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 87,264,962 (GRCm39) missense probably damaging 1.00
R0023:Abcc12 UTSW 8 87,264,962 (GRCm39) missense probably damaging 1.00
R0116:Abcc12 UTSW 8 87,261,627 (GRCm39) missense probably benign 0.00
R0131:Abcc12 UTSW 8 87,258,197 (GRCm39) missense probably benign
R0131:Abcc12 UTSW 8 87,258,197 (GRCm39) missense probably benign
R0132:Abcc12 UTSW 8 87,258,197 (GRCm39) missense probably benign
R0308:Abcc12 UTSW 8 87,284,381 (GRCm39) splice site probably benign
R0589:Abcc12 UTSW 8 87,287,101 (GRCm39) missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 87,284,322 (GRCm39) missense probably damaging 1.00
R1564:Abcc12 UTSW 8 87,244,115 (GRCm39) missense probably benign 0.10
R1740:Abcc12 UTSW 8 87,236,400 (GRCm39) missense possibly damaging 0.78
R1740:Abcc12 UTSW 8 87,232,126 (GRCm39) nonsense probably null
R1970:Abcc12 UTSW 8 87,253,910 (GRCm39) missense probably benign 0.27
R2017:Abcc12 UTSW 8 87,290,617 (GRCm39) missense probably damaging 1.00
R2026:Abcc12 UTSW 8 87,284,862 (GRCm39) missense probably benign 0.30
R2402:Abcc12 UTSW 8 87,235,770 (GRCm39) missense probably damaging 1.00
R3085:Abcc12 UTSW 8 87,270,536 (GRCm39) splice site probably benign
R3115:Abcc12 UTSW 8 87,266,653 (GRCm39) critical splice donor site probably null
R3176:Abcc12 UTSW 8 87,233,495 (GRCm39) missense probably damaging 1.00
R3276:Abcc12 UTSW 8 87,233,495 (GRCm39) missense probably damaging 1.00
R3847:Abcc12 UTSW 8 87,280,020 (GRCm39) missense probably benign 0.05
R3911:Abcc12 UTSW 8 87,255,048 (GRCm39) splice site probably benign
R4031:Abcc12 UTSW 8 87,244,077 (GRCm39) missense probably damaging 1.00
R4297:Abcc12 UTSW 8 87,258,154 (GRCm39) splice site probably null
R4298:Abcc12 UTSW 8 87,258,154 (GRCm39) splice site probably null
R4299:Abcc12 UTSW 8 87,258,154 (GRCm39) splice site probably null
R4688:Abcc12 UTSW 8 87,275,323 (GRCm39) missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 87,287,471 (GRCm39) missense probably damaging 1.00
R4863:Abcc12 UTSW 8 87,265,005 (GRCm39) missense probably damaging 1.00
R4892:Abcc12 UTSW 8 87,236,431 (GRCm39) missense probably benign 0.28
R5288:Abcc12 UTSW 8 87,293,168 (GRCm39) missense probably damaging 1.00
R5303:Abcc12 UTSW 8 87,236,415 (GRCm39) missense probably benign 0.15
R5332:Abcc12 UTSW 8 87,251,459 (GRCm39) splice site probably null
R5386:Abcc12 UTSW 8 87,244,118 (GRCm39) missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 87,236,473 (GRCm39) missense probably benign 0.03
R5900:Abcc12 UTSW 8 87,293,149 (GRCm39) missense possibly damaging 0.90
R6035:Abcc12 UTSW 8 87,244,033 (GRCm39) missense probably damaging 0.98
R6035:Abcc12 UTSW 8 87,244,033 (GRCm39) missense probably damaging 0.98
R6291:Abcc12 UTSW 8 87,293,173 (GRCm39) missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 87,235,718 (GRCm39)
R6677:Abcc12 UTSW 8 87,261,381 (GRCm39) missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 87,287,486 (GRCm39) missense possibly damaging 0.94
R7619:Abcc12 UTSW 8 87,293,182 (GRCm39) missense probably damaging 1.00
R7808:Abcc12 UTSW 8 87,234,568 (GRCm39) missense probably benign 0.03
R7828:Abcc12 UTSW 8 87,254,904 (GRCm39) missense probably benign 0.08
R7834:Abcc12 UTSW 8 87,284,859 (GRCm39) missense probably damaging 1.00
R7834:Abcc12 UTSW 8 87,258,179 (GRCm39) missense possibly damaging 0.81
R7939:Abcc12 UTSW 8 87,275,433 (GRCm39) missense probably damaging 1.00
R7989:Abcc12 UTSW 8 87,232,108 (GRCm39) missense probably benign 0.02
R8290:Abcc12 UTSW 8 87,238,911 (GRCm39) missense probably damaging 0.99
R8681:Abcc12 UTSW 8 87,231,908 (GRCm39) missense possibly damaging 0.74
R8795:Abcc12 UTSW 8 87,258,213 (GRCm39) missense possibly damaging 0.87
R8811:Abcc12 UTSW 8 87,280,023 (GRCm39) missense probably damaging 1.00
R8939:Abcc12 UTSW 8 87,243,947 (GRCm39) missense probably damaging 1.00
R8940:Abcc12 UTSW 8 87,287,440 (GRCm39) missense probably benign 0.45
R9711:Abcc12 UTSW 8 87,275,388 (GRCm39) missense probably damaging 1.00
X0027:Abcc12 UTSW 8 87,279,920 (GRCm39) missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 87,286,908 (GRCm39) splice site probably null
Z1176:Abcc12 UTSW 8 87,277,230 (GRCm39) missense probably damaging 1.00
Z1177:Abcc12 UTSW 8 87,254,013 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCTGCACTTGAGAAGAATTGG -3'
(R):5'- CTTTGCAGGAGTTTGCCCAC -3'

Sequencing Primer
(F):5'- GGGTTTATGGAAATTCACCCTCAAGG -3'
(R):5'- CCACCAAAGCAATTGTAGCTGATTG -3'
Posted On 2019-10-07