Incidental Mutation 'R7411:Pmfbp1'
ID575085
Institutional Source Beutler Lab
Gene Symbol Pmfbp1
Ensembl Gene ENSMUSG00000031727
Gene Namepolyamine modulated factor 1 binding protein 1
SynonymsF77, 1700016D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109494027-109542640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109513871 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 195 (Y195F)
Ref Sequence ENSEMBL: ENSMUSP00000034162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034162]
Predicted Effect probably damaging
Transcript: ENSMUST00000034162
AA Change: Y195F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034162
Gene: ENSMUSG00000031727
AA Change: Y195F

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
internal_repeat_1 38 84 9.43e-6 PROSPERO
coiled coil region 89 121 N/A INTRINSIC
internal_repeat_1 138 178 9.43e-6 PROSPERO
coiled coil region 197 223 N/A INTRINSIC
coiled coil region 334 377 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
coiled coil region 411 732 N/A INTRINSIC
coiled coil region 758 879 N/A INTRINSIC
coiled coil region 931 968 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Pmfbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Pmfbp1 APN 8 109537993 missense possibly damaging 0.75
IGL01505:Pmfbp1 APN 8 109513911 missense probably damaging 1.00
IGL01609:Pmfbp1 APN 8 109527716 missense probably benign 0.12
IGL02066:Pmfbp1 APN 8 109541733 missense possibly damaging 0.76
IGL02926:Pmfbp1 APN 8 109520249 missense probably damaging 1.00
IGL03374:Pmfbp1 APN 8 109542414 utr 3 prime probably benign
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0046:Pmfbp1 UTSW 8 109535985 splice site probably benign
R0068:Pmfbp1 UTSW 8 109542379 splice site probably benign
R0211:Pmfbp1 UTSW 8 109541740 missense probably benign 0.03
R0244:Pmfbp1 UTSW 8 109541673 missense probably damaging 1.00
R0468:Pmfbp1 UTSW 8 109513968 splice site probably null
R0479:Pmfbp1 UTSW 8 109530473 splice site probably benign
R1124:Pmfbp1 UTSW 8 109530483 critical splice acceptor site probably null
R1332:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1336:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1621:Pmfbp1 UTSW 8 109499538 missense probably benign 0.04
R1961:Pmfbp1 UTSW 8 109530144 splice site probably benign
R2069:Pmfbp1 UTSW 8 109532103 missense possibly damaging 0.68
R2125:Pmfbp1 UTSW 8 109520273 missense probably damaging 1.00
R2889:Pmfbp1 UTSW 8 109525431 missense probably damaging 0.99
R3034:Pmfbp1 UTSW 8 109520921 critical splice acceptor site probably null
R3956:Pmfbp1 UTSW 8 109530169 missense probably benign 0.25
R4085:Pmfbp1 UTSW 8 109494947 missense possibly damaging 0.92
R4191:Pmfbp1 UTSW 8 109527628 missense probably benign 0.00
R4410:Pmfbp1 UTSW 8 109532063 missense probably benign 0.07
R4418:Pmfbp1 UTSW 8 109530633 missense probably benign 0.36
R4888:Pmfbp1 UTSW 8 109532160 missense probably damaging 1.00
R4937:Pmfbp1 UTSW 8 109535866 missense probably benign
R5070:Pmfbp1 UTSW 8 109530155 missense probably damaging 0.99
R5184:Pmfbp1 UTSW 8 109527767 missense possibly damaging 0.92
R5552:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
R5609:Pmfbp1 UTSW 8 109525107 missense probably damaging 1.00
R5760:Pmfbp1 UTSW 8 109521023 missense probably damaging 0.99
R5818:Pmfbp1 UTSW 8 109538679 splice site probably null
R6378:Pmfbp1 UTSW 8 109530266 missense probably damaging 0.99
R6496:Pmfbp1 UTSW 8 109532157 missense probably null 0.04
R6550:Pmfbp1 UTSW 8 109520207 missense possibly damaging 0.90
R6565:Pmfbp1 UTSW 8 109525428 nonsense probably null
R6624:Pmfbp1 UTSW 8 109530190 missense possibly damaging 0.92
R6684:Pmfbp1 UTSW 8 109535830 missense probably benign 0.10
R6823:Pmfbp1 UTSW 8 109530307 missense possibly damaging 0.92
R6833:Pmfbp1 UTSW 8 109538675 critical splice donor site probably null
R6940:Pmfbp1 UTSW 8 109525191 missense probably damaging 0.98
R7000:Pmfbp1 UTSW 8 109530589 missense possibly damaging 0.92
R7563:Pmfbp1 UTSW 8 109525374 missense possibly damaging 0.83
R7782:Pmfbp1 UTSW 8 109527780 missense probably damaging 0.96
X0065:Pmfbp1 UTSW 8 109535867 missense probably benign 0.25
Z1088:Pmfbp1 UTSW 8 109513944 missense probably damaging 1.00
Z1176:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGACGTGCTCACTACACG -3'
(R):5'- CGCTTCCAAATTGAATGGTGG -3'

Sequencing Primer
(F):5'- GCTCACTACACGCCTTCATGG -3'
(R):5'- CTTCCAAATTGAATGGTGGGAGGAAC -3'
Posted On2019-10-07