Incidental Mutation 'R7411:Adamts18'
ID 575086
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
Synonyms E130314N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 113697126-113848738 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113777730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 243 (Y243C)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
AlphaFold Q4VC17
Predicted Effect probably damaging
Transcript: ENSMUST00000093113
AA Change: Y243C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: Y243C

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000212665
AA Change: Y86C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 113774943 missense probably damaging 1.00
IGL01548:Adamts18 APN 8 113764299 missense probably damaging 1.00
IGL01556:Adamts18 APN 8 113845109 missense probably benign 0.01
IGL01833:Adamts18 APN 8 113743096 missense probably benign 0.10
IGL02187:Adamts18 APN 8 113713194 missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 113699072 missense probably damaging 1.00
IGL02756:Adamts18 APN 8 113714344 splice site probably benign
IGL03188:Adamts18 APN 8 113699024 missense probably damaging 1.00
IGL03411:Adamts18 APN 8 113764297 nonsense probably null
G1patch:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R0119:Adamts18 UTSW 8 113774953 missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 113743117 missense probably damaging 1.00
R0410:Adamts18 UTSW 8 113714358 nonsense probably null
R0480:Adamts18 UTSW 8 113738818 missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 113738769 splice site probably null
R0924:Adamts18 UTSW 8 113705396 splice site probably null
R0930:Adamts18 UTSW 8 113705396 splice site probably null
R1333:Adamts18 UTSW 8 113705173 splice site probably benign
R1441:Adamts18 UTSW 8 113754562 critical splice donor site probably null
R2082:Adamts18 UTSW 8 113775333 missense probably damaging 1.00
R2146:Adamts18 UTSW 8 113845003 missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 113705261 missense probably benign 0.36
R3148:Adamts18 UTSW 8 113738858 missense probably damaging 1.00
R3963:Adamts18 UTSW 8 113777811 missense probably benign 0.00
R4056:Adamts18 UTSW 8 113737580 nonsense probably null
R4486:Adamts18 UTSW 8 113713193 missense probably benign 0.00
R4608:Adamts18 UTSW 8 113737613 missense probably damaging 1.00
R4624:Adamts18 UTSW 8 113773168 nonsense probably null
R4626:Adamts18 UTSW 8 113773168 nonsense probably null
R4627:Adamts18 UTSW 8 113773168 nonsense probably null
R4628:Adamts18 UTSW 8 113773168 nonsense probably null
R4629:Adamts18 UTSW 8 113773168 nonsense probably null
R4710:Adamts18 UTSW 8 113706926 missense probably damaging 0.98
R4959:Adamts18 UTSW 8 113736725 nonsense probably null
R4973:Adamts18 UTSW 8 113736725 nonsense probably null
R4976:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5119:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5141:Adamts18 UTSW 8 113775270 missense probably damaging 1.00
R5422:Adamts18 UTSW 8 113698974 missense probably benign 0.06
R5587:Adamts18 UTSW 8 113775360 nonsense probably null
R5868:Adamts18 UTSW 8 113777748 missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 113773077 missense probably damaging 1.00
R5906:Adamts18 UTSW 8 113709619 missense probably benign 0.00
R5942:Adamts18 UTSW 8 113777748 missense probably benign 0.01
R6006:Adamts18 UTSW 8 113706974 missense probably damaging 1.00
R6608:Adamts18 UTSW 8 113775279 missense probably damaging 1.00
R6725:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R7002:Adamts18 UTSW 8 113775290 missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 113775264 missense probably damaging 0.99
R7292:Adamts18 UTSW 8 113709645 missense probably benign 0.00
R7685:Adamts18 UTSW 8 113713223 missense probably damaging 1.00
R7737:Adamts18 UTSW 8 113736934 splice site probably null
R7860:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
R7936:Adamts18 UTSW 8 113767128 missense probably damaging 1.00
R8197:Adamts18 UTSW 8 113754595 missense probably damaging 1.00
R8363:Adamts18 UTSW 8 113767163 missense probably damaging 1.00
R8759:Adamts18 UTSW 8 113706992 missense probably damaging 1.00
R8934:Adamts18 UTSW 8 113736878 missense possibly damaging 0.90
R9405:Adamts18 UTSW 8 113703398 missense probably damaging 1.00
R9422:Adamts18 UTSW 8 113775278 missense probably damaging 1.00
R9450:Adamts18 UTSW 8 113764310 missense probably benign 0.10
R9475:Adamts18 UTSW 8 113777938 missense possibly damaging 0.93
Z1088:Adamts18 UTSW 8 113775440 missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 113743168 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCAATCCTTTTGCTAGGCG -3'
(R):5'- GACAATGAATTCCTCATCTCACCG -3'

Sequencing Primer
(F):5'- TTTGCTAGGCGGCATCC -3'
(R):5'- TACCTCAGCTGCTGGCC -3'
Posted On 2019-10-07