Incidental Mutation 'R7411:Slc35f3'
ID 575087
Institutional Source Beutler Lab
Gene Symbol Slc35f3
Ensembl Gene ENSMUSG00000057060
Gene Name solute carrier family 35, member F3
Synonyms B230375D17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R7411 (G1)
Quality Score 217.468
Status Not validated
Chromosome 8
Chromosomal Location 126298558-126395482 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC at 126389038 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108759]
AlphaFold Q1LZI2
Predicted Effect probably benign
Transcript: ENSMUST00000108759
SMART Domains Protein: ENSMUSP00000104390
Gene: ENSMUSG00000057060

DomainStartEndE-ValueType
low complexity region 25 49 N/A INTRINSIC
Pfam:EamA 67 223 3.2e-7 PFAM
Pfam:SLC35F 145 374 3.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Slc35f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Slc35f3 APN 8 126382164 missense probably benign 0.02
IGL00956:Slc35f3 APN 8 126382224 missense probably damaging 1.00
IGL01105:Slc35f3 APN 8 126298814 missense probably damaging 1.00
IGL01710:Slc35f3 APN 8 126389161 missense probably benign 0.00
IGL01771:Slc35f3 APN 8 126389212 missense probably benign 0.00
IGL02254:Slc35f3 APN 8 126389123 missense probably damaging 1.00
IGL02610:Slc35f3 APN 8 126321217 missense probably damaging 1.00
R1666:Slc35f3 UTSW 8 126389221 missense probably damaging 0.98
R2510:Slc35f3 UTSW 8 126298706 start gained probably benign
R2520:Slc35f3 UTSW 8 126394573 missense possibly damaging 0.81
R3807:Slc35f3 UTSW 8 126389239 missense probably damaging 1.00
R4644:Slc35f3 UTSW 8 126321070 missense possibly damaging 0.87
R4675:Slc35f3 UTSW 8 126321196 nonsense probably null
R4976:Slc35f3 UTSW 8 126389281 splice site probably null
R5037:Slc35f3 UTSW 8 126389272 missense probably damaging 0.99
R5225:Slc35f3 UTSW 8 126391107 missense probably damaging 0.98
R5259:Slc35f3 UTSW 8 126389133 missense probably damaging 1.00
R5856:Slc35f3 UTSW 8 126321080 missense probably benign 0.07
R5925:Slc35f3 UTSW 8 126389207 missense probably benign 0.24
R6254:Slc35f3 UTSW 8 126321094 missense possibly damaging 0.96
R6748:Slc35f3 UTSW 8 126394638 nonsense probably null
R6785:Slc35f3 UTSW 8 126394459 missense probably benign 0.02
R7002:Slc35f3 UTSW 8 126389034 critical splice acceptor site unknown
R7291:Slc35f3 UTSW 8 126394558 missense probably benign 0.02
R7456:Slc35f3 UTSW 8 126389040 critical splice acceptor site unknown
R7790:Slc35f3 UTSW 8 126389038 critical splice acceptor site probably benign
R7852:Slc35f3 UTSW 8 126394480 missense probably damaging 1.00
R8000:Slc35f3 UTSW 8 126321073 missense probably benign
R8277:Slc35f3 UTSW 8 126389186 missense possibly damaging 0.88
R8827:Slc35f3 UTSW 8 126389041 critical splice acceptor site probably benign
R8983:Slc35f3 UTSW 8 126389036 critical splice acceptor site probably benign
R9205:Slc35f3 UTSW 8 126389189 missense probably damaging 0.96
R9355:Slc35f3 UTSW 8 126382228 missense probably damaging 0.97
R9475:Slc35f3 UTSW 8 126382254 missense probably damaging 1.00
R9492:Slc35f3 UTSW 8 126321287 missense probably damaging 1.00
R9714:Slc35f3 UTSW 8 126389042 critical splice acceptor site probably benign
R9729:Slc35f3 UTSW 8 126389038 critical splice acceptor site probably benign
R9769:Slc35f3 UTSW 8 126394597 missense probably damaging 0.99
X0067:Slc35f3 UTSW 8 126382323 missense probably damaging 0.99
Predicted Primers
Posted On 2019-10-07