Incidental Mutation 'R7411:Vps13c'
ID575089
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67972001 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 3408 (M3408K)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: M3408K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: M3408K

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000215524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGCGAACAATAGGTCC -3'
(R):5'- CCAAGATCAACAGTAGATGTGC -3'

Sequencing Primer
(F):5'- TCTGAGGCCACGTGACTACTAAATG -3'
(R):5'- GATCAACAGTAGATGTGCTCATTTG -3'
Posted On2019-10-07