Incidental Mutation 'R7411:Olfr1395'
ID575093
Institutional Source Beutler Lab
Gene Symbol Olfr1395
Ensembl Gene ENSMUSG00000050763
Gene Nameolfactory receptor 1395
SynonymsMOR277-1, GA_x6K02T2QP88-6286247-6285294
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49142274-49150453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49148994 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 246 (M246L)
Ref Sequence ENSEMBL: ENSMUSP00000145357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059379] [ENSMUST00000203377] [ENSMUST00000214195]
Predicted Effect probably benign
Transcript: ENSMUST00000059379
AA Change: M246L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000050142
Gene: ENSMUSG00000050763
AA Change: M246L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 252 4.8e-6 PFAM
Pfam:7tm_1 42 291 1.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203377
AA Change: M246L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000145357
Gene: ENSMUSG00000050763
AA Change: M246L

DomainStartEndE-ValueType
Pfam:7tm_1 1 219 1.9e-18 PFAM
Pfam:7tm_4 1 237 2.4e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214195
AA Change: M246L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Olfr1395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Olfr1395 APN 11 49148557 missense probably damaging 1.00
IGL02946:Olfr1395 APN 11 49148892 missense probably damaging 1.00
R0030:Olfr1395 UTSW 11 49149040 missense possibly damaging 0.81
R1013:Olfr1395 UTSW 11 49149150 missense probably damaging 1.00
R1577:Olfr1395 UTSW 11 49149189 missense probably benign 0.05
R1908:Olfr1395 UTSW 11 49148274 missense possibly damaging 0.95
R3715:Olfr1395 UTSW 11 49148815 missense probably damaging 0.99
R4386:Olfr1395 UTSW 11 49149015 missense probably damaging 1.00
R4496:Olfr1395 UTSW 11 49148387 missense possibly damaging 0.86
R5030:Olfr1395 UTSW 11 49148361 missense probably benign 0.01
R6044:Olfr1395 UTSW 11 49148695 missense probably benign 0.29
R6226:Olfr1395 UTSW 11 49148833 missense possibly damaging 0.81
R7177:Olfr1395 UTSW 11 49149185 nonsense probably null
R7282:Olfr1395 UTSW 11 49149118 missense probably damaging 1.00
R7391:Olfr1395 UTSW 11 49148979 missense probably damaging 1.00
R7888:Olfr1395 UTSW 11 49148439 missense probably damaging 1.00
R7971:Olfr1395 UTSW 11 49148439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACCACTTCTTCTGTGAGG -3'
(R):5'- TTTCCCAGTAGTTTCCTCAGGG -3'

Sequencing Primer
(F):5'- AGGTTCCTGCTGTGCTCAAG -3'
(R):5'- AGTAGTTTCCTCAGGGCTCCG -3'
Posted On2019-10-07