Incidental Mutation 'R7411:Nfe2l1'
ID575098
Institutional Source Beutler Lab
Gene Symbol Nfe2l1
Ensembl Gene ENSMUSG00000038615
Gene Namenuclear factor, erythroid derived 2,-like 1
SynonymsLCR-F1, TCF11, NRF1, TCF-11, Lcrf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location96817414-96829968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96822183 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 216 (T216N)
Ref Sequence ENSEMBL: ENSMUSP00000103286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081775] [ENSMUST00000107657] [ENSMUST00000107658] [ENSMUST00000107659] [ENSMUST00000126949] [ENSMUST00000142065] [ENSMUST00000167110] [ENSMUST00000167149] [ENSMUST00000169828]
Predicted Effect probably benign
Transcript: ENSMUST00000081775
AA Change: T216N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080467
Gene: ENSMUSG00000038615
AA Change: T216N

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107657
AA Change: T216N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103284
Gene: ENSMUSG00000038615
AA Change: T216N

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107658
AA Change: T216N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103285
Gene: ENSMUSG00000038615
AA Change: T216N

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107659
AA Change: T216N

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103286
Gene: ENSMUSG00000038615
AA Change: T216N

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 697 1.93e-7 SMART
transmembrane domain 719 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126949
SMART Domains Protein: ENSMUSP00000120512
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
SCOP:d1e5xa_ 22 65 4e-3 SMART
low complexity region 114 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142065
AA Change: T58N

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121423
Gene: ENSMUSG00000038615
AA Change: T58N

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167110
AA Change: T58N

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127804
Gene: ENSMUSG00000038615
AA Change: T58N

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-9 PDB
low complexity region 244 257 N/A INTRINSIC
low complexity region 287 334 N/A INTRINSIC
BRLZ 463 527 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167149
AA Change: T216N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128527
Gene: ENSMUSG00000038615
AA Change: T216N

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169828
SMART Domains Protein: ENSMUSP00000131585
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 157 204 N/A INTRINSIC
BRLZ 333 397 9.8e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases from the use of NRF1 for this gene, NFE2L1, and for "nuclear respiratory factor 1" which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations fail to form a primitive streak, lack mesoderm, show a non-cell autonomous defect in definitive erythropoiesis, and die around embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Nfe2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Nfe2l1 APN 11 96817716 missense probably benign 0.23
IGL02676:Nfe2l1 APN 11 96827665 missense probably damaging 0.97
IGL02868:Nfe2l1 APN 11 96820140 missense probably damaging 1.00
IGL03278:Nfe2l1 APN 11 96822192 missense probably benign 0.04
R0218:Nfe2l1 UTSW 11 96827613 missense probably damaging 1.00
R0453:Nfe2l1 UTSW 11 96827368 missense probably damaging 0.99
R0637:Nfe2l1 UTSW 11 96827688 missense probably damaging 1.00
R3891:Nfe2l1 UTSW 11 96819997 missense possibly damaging 0.93
R4108:Nfe2l1 UTSW 11 96819394 critical splice donor site probably null
R4234:Nfe2l1 UTSW 11 96819909 missense probably damaging 1.00
R4720:Nfe2l1 UTSW 11 96827689 missense probably damaging 1.00
R5102:Nfe2l1 UTSW 11 96822108 missense probably damaging 0.99
R5319:Nfe2l1 UTSW 11 96819379 missense probably damaging 0.98
R5929:Nfe2l1 UTSW 11 96827359 missense probably damaging 0.99
R6263:Nfe2l1 UTSW 11 96817744 missense probably benign 0.23
R6375:Nfe2l1 UTSW 11 96820051 missense probably damaging 1.00
R6450:Nfe2l1 UTSW 11 96827335 missense possibly damaging 0.80
R6705:Nfe2l1 UTSW 11 96827625 missense probably damaging 1.00
R6907:Nfe2l1 UTSW 11 96819810 missense probably damaging 1.00
R7161:Nfe2l1 UTSW 11 96817720 missense probably benign 0.23
R7420:Nfe2l1 UTSW 11 96819913 missense probably benign 0.02
R7495:Nfe2l1 UTSW 11 96819796 missense probably damaging 0.98
R7625:Nfe2l1 UTSW 11 96819445 missense probably damaging 1.00
R8134:Nfe2l1 UTSW 11 96819759 missense possibly damaging 0.83
R8252:Nfe2l1 UTSW 11 96819232 missense probably benign 0.00
R8762:Nfe2l1 UTSW 11 96820480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCAAGTGTTCTGGAAGTG -3'
(R):5'- CTCATTGGAGCGTCAGTAGG -3'

Sequencing Primer
(F):5'- AAGTGTTCCAGCATGGTGAGTC -3'
(R):5'- TAGGACCGGGAGCTTTCTC -3'
Posted On2019-10-07