Incidental Mutation 'R7411:Supt16'
ID 575106
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name SPT16, facilitates chromatin remodeling subunit
Synonyms Spt16, Fact140, Supt16h, Cdc68
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52397876-52434696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52415508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 409 (V409E)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: V409E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V409E

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52,399,255 (GRCm39) missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52,399,148 (GRCm39) missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52,420,589 (GRCm39) missense probably benign
IGL01328:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01329:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01413:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01414:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01535:Supt16 APN 14 52,414,647 (GRCm39) missense probably damaging 0.99
IGL01765:Supt16 APN 14 52,417,680 (GRCm39) missense probably damaging 0.98
IGL01976:Supt16 APN 14 52,419,764 (GRCm39) missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52,417,000 (GRCm39) missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52,411,263 (GRCm39) missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52,421,421 (GRCm39) missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52,408,335 (GRCm39) missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52,413,855 (GRCm39) missense probably damaging 0.98
IGL03406:Supt16 APN 14 52,415,598 (GRCm39) missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
watercolor UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R0332:Supt16 UTSW 14 52,418,614 (GRCm39) missense probably damaging 0.99
R0385:Supt16 UTSW 14 52,414,175 (GRCm39) missense probably benign 0.01
R0389:Supt16 UTSW 14 52,411,570 (GRCm39) missense probably damaging 0.98
R0422:Supt16 UTSW 14 52,421,453 (GRCm39) missense probably benign 0.26
R1101:Supt16 UTSW 14 52,408,896 (GRCm39) missense probably null 0.81
R1212:Supt16 UTSW 14 52,411,581 (GRCm39) nonsense probably null
R1487:Supt16 UTSW 14 52,414,065 (GRCm39) critical splice donor site probably null
R1494:Supt16 UTSW 14 52,409,916 (GRCm39) missense probably benign 0.01
R1566:Supt16 UTSW 14 52,414,112 (GRCm39) missense probably damaging 0.99
R1652:Supt16 UTSW 14 52,414,637 (GRCm39) missense probably benign 0.34
R1913:Supt16 UTSW 14 52,415,592 (GRCm39) missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52,409,601 (GRCm39) nonsense probably null
R2344:Supt16 UTSW 14 52,415,575 (GRCm39) missense probably benign 0.00
R3430:Supt16 UTSW 14 52,412,816 (GRCm39) missense probably benign 0.05
R3746:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R3749:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R4010:Supt16 UTSW 14 52,401,898 (GRCm39) missense probably damaging 1.00
R4108:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4109:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4597:Supt16 UTSW 14 52,411,046 (GRCm39) missense probably damaging 1.00
R5117:Supt16 UTSW 14 52,420,549 (GRCm39) missense probably damaging 1.00
R5309:Supt16 UTSW 14 52,400,155 (GRCm39) missense probably damaging 1.00
R5695:Supt16 UTSW 14 52,411,601 (GRCm39) splice site probably null
R5895:Supt16 UTSW 14 52,401,979 (GRCm39) missense probably benign 0.17
R5941:Supt16 UTSW 14 52,419,653 (GRCm39) missense probably benign
R5993:Supt16 UTSW 14 52,415,791 (GRCm39) missense probably damaging 1.00
R6197:Supt16 UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R6254:Supt16 UTSW 14 52,408,291 (GRCm39) missense probably damaging 1.00
R6381:Supt16 UTSW 14 52,417,003 (GRCm39) missense probably benign 0.02
R6667:Supt16 UTSW 14 52,409,520 (GRCm39) missense probably damaging 1.00
R7000:Supt16 UTSW 14 52,408,907 (GRCm39) missense probably damaging 0.97
R7063:Supt16 UTSW 14 52,409,505 (GRCm39) missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52,414,458 (GRCm39) missense probably benign
R7336:Supt16 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52,411,028 (GRCm39) missense probably damaging 0.98
R7384:Supt16 UTSW 14 52,418,619 (GRCm39) missense probably damaging 0.99
R7586:Supt16 UTSW 14 52,411,013 (GRCm39) missense probably damaging 0.97
R7633:Supt16 UTSW 14 52,434,556 (GRCm39) missense probably benign 0.38
R8024:Supt16 UTSW 14 52,408,332 (GRCm39) missense probably damaging 0.96
R8197:Supt16 UTSW 14 52,411,542 (GRCm39) missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52,408,447 (GRCm39) missense probably damaging 1.00
R8285:Supt16 UTSW 14 52,418,540 (GRCm39) missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52,419,046 (GRCm39) missense probably damaging 1.00
R8531:Supt16 UTSW 14 52,410,020 (GRCm39) missense probably damaging 0.98
R8797:Supt16 UTSW 14 52,409,960 (GRCm39) missense probably damaging 0.99
R8872:Supt16 UTSW 14 52,411,544 (GRCm39) missense probably benign 0.01
R9048:Supt16 UTSW 14 52,418,513 (GRCm39) missense probably damaging 1.00
R9743:Supt16 UTSW 14 52,408,939 (GRCm39) missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52,418,994 (GRCm39) missense probably null 0.21
Z1177:Supt16 UTSW 14 52,400,742 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTGATAAGGACATCGAATGCCC -3'
(R):5'- CCGTGAAGGCTCTCTAGTAATC -3'

Sequencing Primer
(F):5'- GGACATCGAATGCCCCTTCATTC -3'
(R):5'- CGTGAAGGCTCTCTAGTAATCAATAG -3'
Posted On 2019-10-07