Incidental Mutation 'R7411:Muc4'
ID 575109
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Name mucin 4
Synonyms 4933405I11Rik
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 32555089-32602761 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32570140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 400 (V400A)
Ref Sequence ENSEMBL: ENSMUSP00000093813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000096106
AA Change: V400A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: V400A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132475
SMART Domains Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 38 45 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 99 127 N/A INTRINSIC
low complexity region 148 173 N/A INTRINSIC
low complexity region 192 224 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Nphp4 T A 4: 152,639,174 (GRCm39) I935N probably benign Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00088:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00089:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00090:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00091:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00092:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00163:Muc4 APN 16 32,754,090 (GRCm38) missense probably benign 0.20
IGL00324:Muc4 APN 16 32,599,186 (GRCm39) missense probably benign 0.03
IGL00331:Muc4 APN 16 32,574,613 (GRCm39) missense probably benign 0.01
IGL00539:Muc4 APN 16 32,569,728 (GRCm39) missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32,575,465 (GRCm39) missense probably benign 0.10
IGL00990:Muc4 APN 16 32,753,886 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,753,863 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,752,569 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,140 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,139 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,114 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,576,179 (GRCm39) unclassified probably benign
IGL00990:Muc4 APN 16 32,575,246 (GRCm39) missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32,575,362 (GRCm39) missense probably benign 0.01
IGL01091:Muc4 APN 16 32,753,927 (GRCm38) missense probably benign 0.04
IGL01124:Muc4 APN 16 32,589,104 (GRCm39) missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32,753,901 (GRCm38) missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32,584,340 (GRCm39) missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32,569,473 (GRCm39) missense probably benign 0.23
IGL01618:Muc4 APN 16 32,577,001 (GRCm39) missense unknown
IGL01625:Muc4 APN 16 32,575,918 (GRCm39) unclassified probably benign
IGL01626:Muc4 APN 16 32,555,220 (GRCm39) missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32,581,722 (GRCm39) splice site probably null
IGL01682:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL01870:Muc4 APN 16 32,574,624 (GRCm39) missense probably benign 0.01
IGL01966:Muc4 APN 16 32,570,244 (GRCm39) missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32,575,383 (GRCm39) missense probably benign 0.01
IGL02089:Muc4 APN 16 32,570,131 (GRCm39) missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32,598,023 (GRCm39) splice site probably benign
IGL02210:Muc4 APN 16 32,574,054 (GRCm39) missense probably benign 0.00
IGL02278:Muc4 APN 16 32,754,529 (GRCm38) missense probably benign 0.01
IGL02280:Muc4 APN 16 32,754,529 (GRCm38) missense probably benign 0.01
IGL02316:Muc4 APN 16 32,569,668 (GRCm39) missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32,569,804 (GRCm39) missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32,569,804 (GRCm39) missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32,570,894 (GRCm39) missense probably benign 0.41
IGL02449:Muc4 APN 16 32,576,503 (GRCm39) unclassified probably benign
IGL02607:Muc4 APN 16 32,596,193 (GRCm39) missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32,575,656 (GRCm39) unclassified probably benign
IGL02893:Muc4 APN 16 32,570,466 (GRCm39) missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32,569,212 (GRCm39) missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32,570,866 (GRCm39) missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32,570,766 (GRCm39) missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32,570,257 (GRCm39) nonsense probably null
IGL03335:Muc4 APN 16 32,574,449 (GRCm39) missense probably benign 0.01
IGL03411:Muc4 APN 16 32,575,436 (GRCm39) missense probably benign 0.01
multisplendored UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
protean UTSW 16 32,754,689 (GRCm38) missense probably benign 0.00
R0864_muc4_269 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
3-1:Muc4 UTSW 16 32,590,768 (GRCm39) missense possibly damaging 0.86
3-1:Muc4 UTSW 16 32,580,625 (GRCm39) splice site probably benign
BB004:Muc4 UTSW 16 32,592,011 (GRCm39) missense
BB014:Muc4 UTSW 16 32,592,011 (GRCm39) missense
IGL02835:Muc4 UTSW 16 32,584,319 (GRCm39) missense probably benign 0.32
P0035:Muc4 UTSW 16 32,580,622 (GRCm39) splice site probably benign
PIT4131001:Muc4 UTSW 16 32,755,684 (GRCm38) unclassified probably benign
PIT4131001:Muc4 UTSW 16 32,755,699 (GRCm38) unclassified probably benign
PIT4131001:Muc4 UTSW 16 32,755,676 (GRCm38) unclassified probably benign
PIT4142001:Muc4 UTSW 16 32,755,684 (GRCm38) unclassified probably benign
PIT4142001:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32,755,676 (GRCm38) unclassified probably benign
PIT4366001:Muc4 UTSW 16 32,575,542 (GRCm39) missense unknown
PIT4531001:Muc4 UTSW 16 32,576,391 (GRCm39) missense unknown
R0119:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32,591,978 (GRCm39) missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32,586,120 (GRCm39) missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32,755,690 (GRCm38) unclassified probably benign
R0299:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32,574,333 (GRCm39) missense probably benign 0.00
R0462:Muc4 UTSW 16 32,582,910 (GRCm39) missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32,569,887 (GRCm39) missense probably benign 0.01
R0508:Muc4 UTSW 16 32,570,131 (GRCm39) missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32,577,120 (GRCm39) missense unknown
R0578:Muc4 UTSW 16 32,755,690 (GRCm38) unclassified probably benign
R0617:Muc4 UTSW 16 32,570,925 (GRCm39) missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32,570,488 (GRCm39) missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32,590,201 (GRCm39) missense probably damaging 0.99
R0727:Muc4 UTSW 16 32,590,221 (GRCm39) missense probably benign 0.01
R0776:Muc4 UTSW 16 32,574,020 (GRCm39) missense probably benign 0.04
R0854:Muc4 UTSW 16 32,599,329 (GRCm39) missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
R0864:Muc4 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
R0926:Muc4 UTSW 16 32,576,570 (GRCm39) unclassified probably benign
R0990:Muc4 UTSW 16 32,752,722 (GRCm38) missense probably benign 0.00
R1127:Muc4 UTSW 16 32,569,343 (GRCm39) missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R1433:Muc4 UTSW 16 32,574,448 (GRCm39) missense probably benign 0.00
R1466:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1466:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1506:Muc4 UTSW 16 32,574,033 (GRCm39) missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32,569,167 (GRCm39) missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1584:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1593:Muc4 UTSW 16 32,754,686 (GRCm38) missense probably benign 0.00
R1601:Muc4 UTSW 16 32,575,875 (GRCm39) unclassified probably benign
R1611:Muc4 UTSW 16 32,569,804 (GRCm39) missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32,577,276 (GRCm39) missense probably benign 0.11
R1717:Muc4 UTSW 16 32,753,405 (GRCm38) missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1824:Muc4 UTSW 16 32,576,307 (GRCm39) unclassified probably benign
R1839:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1846:Muc4 UTSW 16 32,752,369 (GRCm38) missense probably benign 0.01
R1864:Muc4 UTSW 16 32,576,625 (GRCm39) unclassified probably benign
R1868:Muc4 UTSW 16 32,576,715 (GRCm39) missense unknown
R1928:Muc4 UTSW 16 32,569,350 (GRCm39) missense probably damaging 0.99
R1942:Muc4 UTSW 16 32,569,460 (GRCm39) missense probably damaging 0.99
R2017:Muc4 UTSW 16 32,570,121 (GRCm39) missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32,574,054 (GRCm39) missense probably benign 0.00
R2081:Muc4 UTSW 16 32,574,020 (GRCm39) missense probably benign 0.04
R2088:Muc4 UTSW 16 32,576,783 (GRCm39) missense unknown
R2121:Muc4 UTSW 16 32,580,612 (GRCm39) missense unknown
R2139:Muc4 UTSW 16 32,581,599 (GRCm39) missense unknown
R2158:Muc4 UTSW 16 32,754,563 (GRCm38) missense probably benign 0.10
R2165:Muc4 UTSW 16 32,569,294 (GRCm39) missense probably damaging 0.96
R2210:Muc4 UTSW 16 32,755,176 (GRCm38) frame shift probably null
R2225:Muc4 UTSW 16 32,587,316 (GRCm39) missense possibly damaging 0.73
R2225:Muc4 UTSW 16 32,576,265 (GRCm39) unclassified probably benign
R2269:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R2679:Muc4 UTSW 16 32,577,846 (GRCm39) missense unknown
R3703:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R3816:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R3909:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4014:Muc4 UTSW 16 32,575,647 (GRCm39) unclassified probably benign
R4065:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4249:Muc4 UTSW 16 32,576,200 (GRCm39) unclassified probably benign
R4344:Muc4 UTSW 16 32,590,666 (GRCm39) missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4393:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R4482:Muc4 UTSW 16 32,577,075 (GRCm39) missense unknown
R4523:Muc4 UTSW 16 32,555,154 (GRCm39) utr 5 prime probably benign
R4527:Muc4 UTSW 16 32,576,217 (GRCm39) unclassified probably benign
R4572:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4587:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4614:Muc4 UTSW 16 32,577,432 (GRCm39) missense probably benign 0.03
R4635:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4661:Muc4 UTSW 16 32,589,651 (GRCm39) missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32,576,220 (GRCm39) unclassified probably benign
R4730:Muc4 UTSW 16 32,570,032 (GRCm39) missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32,596,277 (GRCm39) missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32,574,916 (GRCm39) unclassified probably benign
R4818:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4821:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4825:Muc4 UTSW 16 32,570,565 (GRCm39) missense probably benign 0.41
R4830:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4860:Muc4 UTSW 16 32,754,625 (GRCm38) missense probably benign 0.18
R4860:Muc4 UTSW 16 32,754,616 (GRCm38) missense probably benign 0.35
R4869:Muc4 UTSW 16 32,754,836 (GRCm38) unclassified probably benign
R4934:Muc4 UTSW 16 32,576,472 (GRCm39) unclassified probably benign
R4959:Muc4 UTSW 16 32,575,437 (GRCm39) missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32,754,572 (GRCm38) missense probably benign 0.01
R4995:Muc4 UTSW 16 32,575,332 (GRCm39) missense probably benign 0.01
R4995:Muc4 UTSW 16 32,754,214 (GRCm38) missense probably benign 0.01
R4999:Muc4 UTSW 16 32,576,670 (GRCm39) unclassified probably benign
R5073:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R5075:Muc4 UTSW 16 32,754,794 (GRCm38) unclassified probably benign
R5152:Muc4 UTSW 16 32,577,432 (GRCm39) nonsense probably null
R5161:Muc4 UTSW 16 32,582,895 (GRCm39) missense probably damaging 0.98
R5174:Muc4 UTSW 16 32,570,556 (GRCm39) missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32,570,484 (GRCm39) missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R5474:Muc4 UTSW 16 32,581,635 (GRCm39) missense unknown
R5567:Muc4 UTSW 16 32,598,066 (GRCm39) missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32,598,066 (GRCm39) missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32,754,253 (GRCm38) missense probably benign 0.01
R5665:Muc4 UTSW 16 32,569,600 (GRCm39) missense probably benign 0.33
R5667:Muc4 UTSW 16 32,575,011 (GRCm39) missense probably benign 0.01
R5671:Muc4 UTSW 16 32,575,011 (GRCm39) missense probably benign 0.01
R5693:Muc4 UTSW 16 32,597,181 (GRCm39) missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32,555,059 (GRCm39) nonsense probably null
R5708:Muc4 UTSW 16 32,575,515 (GRCm39) unclassified probably benign
R5715:Muc4 UTSW 16 32,570,734 (GRCm39) missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32,595,213 (GRCm39) missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32,570,113 (GRCm39) missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32,570,523 (GRCm39) missense probably benign 0.41
R5933:Muc4 UTSW 16 32,574,480 (GRCm39) missense probably benign 0.01
R5966:Muc4 UTSW 16 32,576,652 (GRCm39) unclassified probably benign
R6062:Muc4 UTSW 16 32,579,682 (GRCm39) missense unknown
R6067:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R6067:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6078:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6079:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6112:Muc4 UTSW 16 32,596,157 (GRCm39) missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32,577,169 (GRCm39) missense unknown
R6144:Muc4 UTSW 16 32,587,298 (GRCm39) missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R6173:Muc4 UTSW 16 32,554,958 (GRCm39) start gained probably benign
R6268:Muc4 UTSW 16 32,589,141 (GRCm39) missense probably damaging 0.99
R6299:Muc4 UTSW 16 32,570,853 (GRCm39) missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32,575,237 (GRCm39) missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32,575,476 (GRCm39) missense probably benign 0.19
R6361:Muc4 UTSW 16 32,587,725 (GRCm39) missense probably benign 0.32
R6375:Muc4 UTSW 16 32,555,061 (GRCm39) utr 5 prime probably benign
R6378:Muc4 UTSW 16 32,599,320 (GRCm39) missense probably benign 0.33
R6418:Muc4 UTSW 16 32,570,607 (GRCm39) missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32,579,694 (GRCm39) critical splice donor site probably null
R6527:Muc4 UTSW 16 32,753,433 (GRCm38) missense probably benign 0.01
R6616:Muc4 UTSW 16 32,602,378 (GRCm39) missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32,575,255 (GRCm39) missense probably benign 0.01
R6637:Muc4 UTSW 16 32,575,255 (GRCm39) missense probably benign 0.01
R6915:Muc4 UTSW 16 32,587,312 (GRCm39) missense probably benign 0.18
R6947:Muc4 UTSW 16 32,596,177 (GRCm39) missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32,582,892 (GRCm39) missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32,570,817 (GRCm39) missense probably benign 0.00
R7020:Muc4 UTSW 16 32,570,628 (GRCm39) nonsense probably null
R7033:Muc4 UTSW 16 32,576,698 (GRCm39) unclassified probably benign
R7098:Muc4 UTSW 16 32,577,465 (GRCm39) missense
R7123:Muc4 UTSW 16 32,569,509 (GRCm39) missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32,582,862 (GRCm39) missense probably damaging 0.97
R7178:Muc4 UTSW 16 32,752,788 (GRCm38) missense unknown
R7294:Muc4 UTSW 16 32,576,835 (GRCm39) missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32,575,710 (GRCm39) missense unknown
R7361:Muc4 UTSW 16 32,754,670 (GRCm38) missense probably benign 0.18
R7380:Muc4 UTSW 16 32,575,740 (GRCm39) missense unknown
R7381:Muc4 UTSW 16 32,601,285 (GRCm39) missense
R7422:Muc4 UTSW 16 32,754,689 (GRCm38) missense probably benign 0.00
R7482:Muc4 UTSW 16 32,587,324 (GRCm39) missense
R7539:Muc4 UTSW 16 32,576,770 (GRCm39) missense
R7544:Muc4 UTSW 16 32,555,016 (GRCm39) start codon destroyed probably null
R7574:Muc4 UTSW 16 32,753,411 (GRCm38) missense probably benign 0.18
R7576:Muc4 UTSW 16 32,754,500 (GRCm38) missense probably benign 0.10
R7585:Muc4 UTSW 16 32,586,076 (GRCm39) missense
R7596:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7597:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7602:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7616:Muc4 UTSW 16 32,574,161 (GRCm39) nonsense probably null
R7639:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7640:Muc4 UTSW 16 32,580,479 (GRCm39) missense
R7651:Muc4 UTSW 16 32,576,949 (GRCm39) missense
R7688:Muc4 UTSW 16 32,570,278 (GRCm39) missense possibly damaging 0.68
R7689:Muc4 UTSW 16 32,574,439 (GRCm39) missense probably benign 0.10
R7752:Muc4 UTSW 16 32,589,108 (GRCm39) missense
R7763:Muc4 UTSW 16 32,574,739 (GRCm39) missense probably benign 0.10
R7768:Muc4 UTSW 16 32,576,568 (GRCm39) missense unknown
R7787:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7789:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7838:Muc4 UTSW 16 32,752,558 (GRCm38) nonsense probably null
R7871:Muc4 UTSW 16 32,754,935 (GRCm38) missense unknown
R7921:Muc4 UTSW 16 32,570,139 (GRCm39) missense possibly damaging 0.68
R7927:Muc4 UTSW 16 32,592,011 (GRCm39) missense
R7930:Muc4 UTSW 16 32,575,369 (GRCm39) unclassified probably benign
R8000:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8062:Muc4 UTSW 16 32,577,123 (GRCm39) missense
R8096:Muc4 UTSW 16 32,575,764 (GRCm39) missense unknown
R8115:Muc4 UTSW 16 32,575,678 (GRCm39) missense unknown
R8162:Muc4 UTSW 16 32,569,197 (GRCm39) missense unknown
R8220:Muc4 UTSW 16 32,575,701 (GRCm39) missense unknown
R8260:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8290:Muc4 UTSW 16 32,575,434 (GRCm39) missense probably benign 0.01
R8299:Muc4 UTSW 16 32,576,271 (GRCm39) missense unknown
R8313:Muc4 UTSW 16 32,753,423 (GRCm38) missense probably benign 0.04
R8356:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8463:Muc4 UTSW 16 32,574,201 (GRCm39) missense probably benign 0.00
R8479:Muc4 UTSW 16 32,574,799 (GRCm39) missense possibly damaging 0.59
R8480:Muc4 UTSW 16 32,574,421 (GRCm39) missense probably benign 0.20
R8510:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8515:Muc4 UTSW 16 32,575,629 (GRCm39) missense unknown
R8559:Muc4 UTSW 16 32,754,715 (GRCm38) missense unknown
R8685:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8687:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8728:Muc4 UTSW 16 32,754,952 (GRCm38) missense unknown
R8754:Muc4 UTSW 16 32,602,356 (GRCm39) missense
R8845:Muc4 UTSW 16 32,576,889 (GRCm39) missense possibly damaging 0.86
R8852:Muc4 UTSW 16 32,569,461 (GRCm39) missense possibly damaging 0.66
R8863:Muc4 UTSW 16 32,570,280 (GRCm39) missense possibly damaging 0.84
R8896:Muc4 UTSW 16 32,754,673 (GRCm38) missense probably benign 0.01
R8929:Muc4 UTSW 16 32,754,017 (GRCm38) missense possibly damaging 0.53
R8929:Muc4 UTSW 16 32,575,285 (GRCm39) missense probably benign 0.00
R8990:Muc4 UTSW 16 32,574,009 (GRCm39) missense probably benign 0.01
R9018:Muc4 UTSW 16 32,582,910 (GRCm39) missense
R9034:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R9064:Muc4 UTSW 16 32,754,397 (GRCm38) missense possibly damaging 0.53
R9068:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R9086:Muc4 UTSW 16 32,577,842 (GRCm39) missense
R9151:Muc4 UTSW 16 32,752,617 (GRCm38) missense probably benign 0.01
R9187:Muc4 UTSW 16 32,589,102 (GRCm39) missense
R9336:Muc4 UTSW 16 32,569,756 (GRCm39) missense possibly damaging 0.86
R9343:Muc4 UTSW 16 32,569,971 (GRCm39) missense possibly damaging 0.53
R9363:Muc4 UTSW 16 32,576,992 (GRCm39) missense
R9429:Muc4 UTSW 16 32,576,098 (GRCm39) missense unknown
R9570:Muc4 UTSW 16 32,569,695 (GRCm39) missense possibly damaging 0.53
R9609:Muc4 UTSW 16 32,577,234 (GRCm39) missense
R9696:Muc4 UTSW 16 32,574,712 (GRCm39) missense probably benign 0.00
R9709:Muc4 UTSW 16 32,590,644 (GRCm39) missense
R9743:Muc4 UTSW 16 32,601,194 (GRCm39) missense
R9747:Muc4 UTSW 16 32,754,698 (GRCm38) missense probably benign 0.01
RF014:Muc4 UTSW 16 32,570,676 (GRCm39) missense probably damaging 0.98
U15987:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
U15987:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
V5622:Muc4 UTSW 16 32,570,643 (GRCm39) missense probably benign 0.00
X0018:Muc4 UTSW 16 32,575,855 (GRCm39) unclassified probably benign
X0028:Muc4 UTSW 16 32,579,693 (GRCm39) critical splice donor site probably null
Z1088:Muc4 UTSW 16 32,576,450 (GRCm39) unclassified probably benign
Z1176:Muc4 UTSW 16 32,589,104 (GRCm39) missense possibly damaging 0.65
Z1177:Muc4 UTSW 16 32,587,767 (GRCm39) nonsense probably null
Z1177:Muc4 UTSW 16 32,595,236 (GRCm39) missense
Z1177:Muc4 UTSW 16 32,587,768 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTCAACCCTTCCTCAGAAC -3'
(R):5'- TGAGATTTGCTGCTGGTCCC -3'

Sequencing Primer
(F):5'- TGAAAGCATGGACACCAGC -3'
(R):5'- GCTGGTCCCCTTGCTTTGAATATG -3'
Posted On 2019-10-07