Incidental Mutation 'R0626:Adgrg6'
ID57511
Institutional Source Beutler Lab
Gene Symbol Adgrg6
Ensembl Gene ENSMUSG00000039116
Gene Nameadhesion G protein-coupled receptor G6
SynonymsLOC215798, 1190004A11Rik, DREG, Gpr126
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0626 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location14402583-14545659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14436884 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 720 (S720T)
Ref Sequence ENSEMBL: ENSMUSP00000146821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041168] [ENSMUST00000208429]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041168
AA Change: S692T

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043055
Gene: ENSMUSG00000039116
AA Change: S692T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CUB 41 149 8.59e-33 SMART
low complexity region 609 620 N/A INTRINSIC
low complexity region 695 706 N/A INTRINSIC
GPS 769 822 2.48e-12 SMART
Pfam:7tm_2 831 1080 4.1e-52 PFAM
low complexity region 1122 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208429
AA Change: S720T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation die during organogenesis and display signs of circulatory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Adgrg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Adgrg6 APN 10 14467450 missense probably damaging 0.99
IGL00428:Adgrg6 APN 10 14467375 missense probably benign
IGL00489:Adgrg6 APN 10 14440403 splice site probably null
IGL00496:Adgrg6 APN 10 14450578 critical splice donor site probably null
IGL00743:Adgrg6 APN 10 14535959 splice site probably benign
IGL01011:Adgrg6 APN 10 14409798 missense probably damaging 0.96
IGL01291:Adgrg6 APN 10 14410530 missense possibly damaging 0.92
IGL01453:Adgrg6 APN 10 14420458 missense possibly damaging 0.94
IGL01594:Adgrg6 APN 10 14434340 missense probably damaging 1.00
IGL02013:Adgrg6 APN 10 14426811 missense probably damaging 0.98
IGL02037:Adgrg6 APN 10 14441441 missense probably damaging 0.98
IGL02070:Adgrg6 APN 10 14467592 missense probably damaging 1.00
IGL02164:Adgrg6 APN 10 14523555 intron probably benign
IGL02262:Adgrg6 APN 10 14441396 missense probably benign 0.00
IGL02272:Adgrg6 APN 10 14468829 missense probably damaging 1.00
IGL02605:Adgrg6 APN 10 14467232 missense probably damaging 1.00
IGL02800:Adgrg6 APN 10 14420605 missense probably damaging 1.00
IGL03175:Adgrg6 APN 10 14439758 missense probably benign 0.04
ANU05:Adgrg6 UTSW 10 14410530 missense possibly damaging 0.92
R0245:Adgrg6 UTSW 10 14458066 splice site probably benign
R0356:Adgrg6 UTSW 10 14426898 missense possibly damaging 0.47
R0388:Adgrg6 UTSW 10 14450658 missense probably benign 0.00
R0508:Adgrg6 UTSW 10 14450616 missense probably benign 0.32
R1116:Adgrg6 UTSW 10 14438428 missense probably benign 0.00
R1205:Adgrg6 UTSW 10 14434339 missense probably damaging 1.00
R1438:Adgrg6 UTSW 10 14468841 missense possibly damaging 0.68
R1599:Adgrg6 UTSW 10 14467313 nonsense probably null
R1714:Adgrg6 UTSW 10 14439770 missense possibly damaging 0.64
R1728:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1729:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1784:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R2124:Adgrg6 UTSW 10 14467186 missense probably damaging 0.98
R2906:Adgrg6 UTSW 10 14432950 missense probably benign 0.03
R3410:Adgrg6 UTSW 10 14440370 missense probably benign 0.10
R3982:Adgrg6 UTSW 10 14448845 missense probably benign 0.10
R4376:Adgrg6 UTSW 10 14438494 missense probably benign 0.02
R4376:Adgrg6 UTSW 10 14469050 missense probably damaging 1.00
R4445:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4446:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4472:Adgrg6 UTSW 10 14436781 missense probably damaging 1.00
R4622:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4623:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4649:Adgrg6 UTSW 10 14468827 missense probably damaging 1.00
R4882:Adgrg6 UTSW 10 14434337 missense possibly damaging 0.88
R4978:Adgrg6 UTSW 10 14420461 missense probably damaging 1.00
R5246:Adgrg6 UTSW 10 14426765 missense probably damaging 1.00
R5420:Adgrg6 UTSW 10 14426986 nonsense probably null
R5461:Adgrg6 UTSW 10 14420504 missense probably damaging 1.00
R5580:Adgrg6 UTSW 10 14410484 nonsense probably null
R5644:Adgrg6 UTSW 10 14432934 missense probably damaging 1.00
R5847:Adgrg6 UTSW 10 14426777 missense probably damaging 1.00
R5900:Adgrg6 UTSW 10 14438419 critical splice donor site probably null
R6302:Adgrg6 UTSW 10 14441483 missense probably benign 0.22
R6318:Adgrg6 UTSW 10 14467497 missense probably benign
R6319:Adgrg6 UTSW 10 14431622 missense probably damaging 1.00
R6339:Adgrg6 UTSW 10 14434347 missense probably damaging 1.00
R6683:Adgrg6 UTSW 10 14456167 missense probably damaging 0.97
R6983:Adgrg6 UTSW 10 14431695 missense probably damaging 1.00
R7337:Adgrg6 UTSW 10 14467351 missense possibly damaging 0.82
R7378:Adgrg6 UTSW 10 14535892 missense probably benign 0.16
R7463:Adgrg6 UTSW 10 14434396 missense possibly damaging 0.82
R7470:Adgrg6 UTSW 10 14444066 missense probably benign
R7558:Adgrg6 UTSW 10 14431607 missense probably damaging 1.00
R7593:Adgrg6 UTSW 10 14468829 missense probably damaging 1.00
R7747:Adgrg6 UTSW 10 14450577 critical splice donor site probably null
R7768:Adgrg6 UTSW 10 14431666 missense probably benign 0.00
R8049:Adgrg6 UTSW 10 14428199 missense probably benign 0.00
R8059:Adgrg6 UTSW 10 14469050 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAAAAGGTGCTTCCTGCCGAG -3'
(R):5'- GCCTGTGACTGCAAGAGACTTATCC -3'

Sequencing Primer
(F):5'- TGCACATGCTTTAACCCTAGAGG -3'
(R):5'- AGGAATGCCAGACTTCTGC -3'
Posted On2013-07-11