Incidental Mutation 'R7412:Trpa1'
ID575119
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14884198 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 826 (F826I)
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect probably benign
Transcript: ENSMUST00000041447
AA Change: F826I

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: F826I

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7639:Trpa1 UTSW 1 14886913 missense probably benign 0.00
R7740:Trpa1 UTSW 1 14912401 missense possibly damaging 0.72
R7815:Trpa1 UTSW 1 14904262 missense probably benign 0.01
R7854:Trpa1 UTSW 1 14881694 missense probably benign 0.00
R7937:Trpa1 UTSW 1 14881694 missense probably benign 0.00
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Z1176:Trpa1 UTSW 1 14881692 missense probably damaging 1.00
Z1176:Trpa1 UTSW 1 14891306 missense possibly damaging 0.80
Z1176:Trpa1 UTSW 1 14898350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATTTCAGAGCCCTCTACCC -3'
(R):5'- GTATATGGAAAACCAGCTAACCTG -3'

Sequencing Primer
(F):5'- TCTACCCTTCAGCATTACGATATTAG -3'
(R):5'- TATAACTAATCAACCAACCAACTGAC -3'
Posted On2019-10-07