Incidental Mutation 'R7412:Brinp3'
ID575121
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Namebone morphogenetic protein/retinoic acid inducible neural specific 3
SynonymsFam5c, B830045N13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location146494760-146902472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 146902010 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 732 (L732V)
Ref Sequence ENSEMBL: ENSMUSP00000074201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074622
AA Change: L732V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: L732V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166814
AA Change: L732V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: L732V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146901774 missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146901167 missense probably benign
IGL01702:Brinp3 APN 1 146751997 splice site probably benign
IGL01728:Brinp3 APN 1 146831551 splice site probably null
IGL01733:Brinp3 APN 1 146514803 missense probably benign 0.33
IGL01937:Brinp3 APN 1 146901140 missense probably benign
IGL02020:Brinp3 APN 1 146902127 utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146751862 missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146901122 missense probably benign 0.00
IGL02366:Brinp3 APN 1 146701743 missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146902032 missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146701849 splice site probably null
IGL03099:Brinp3 APN 1 146902097 missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0266:Brinp3 UTSW 1 146682680 nonsense probably null
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1522:Brinp3 UTSW 1 146901890 missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146514782 missense probably benign
R1898:Brinp3 UTSW 1 146901249 missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146701841 missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146901920 nonsense probably null
R2272:Brinp3 UTSW 1 146901404 missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146701754 missense probably benign
R2880:Brinp3 UTSW 1 146902002 missense probably damaging 0.98
R3918:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3939:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146901692 missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146727640 intron probably benign
R5009:Brinp3 UTSW 1 146901049 missense probably benign 0.25
R5034:Brinp3 UTSW 1 146727720 intron probably benign
R5166:Brinp3 UTSW 1 146901367 missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146831726 missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146901459 missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146701799 missense probably benign 0.01
R5681:Brinp3 UTSW 1 146901746 missense probably benign 0.12
R6351:Brinp3 UTSW 1 146901585 missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146901906 missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146901693 missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146514889 nonsense probably null
R7223:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146682688 nonsense probably null
R7347:Brinp3 UTSW 1 146902086 missense probably benign 0.22
R7375:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146901401 missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146901563 missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146701671 missense probably damaging 1.00
R7737:Brinp3 UTSW 1 146682594 missense probably damaging 0.98
R7793:Brinp3 UTSW 1 146746568 missense probably benign 0.20
R8334:Brinp3 UTSW 1 146902053 missense probably damaging 0.99
X0060:Brinp3 UTSW 1 146901786 missense probably benign 0.01
Z1176:Brinp3 UTSW 1 146902076 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACCCTGAAGCCATTCG -3'
(R):5'- TGCCATCCAACGTTATTGACTG -3'

Sequencing Primer
(F):5'- AAGCCATTCGGGACCTGATTTTG -3'
(R):5'- TCCAACGTTATTGACTGATATAAGAC -3'
Posted On2019-10-07