Incidental Mutation 'R7412:Xrn2'
ID575126
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name5'-3' exoribonuclease 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location147012996-147078000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147049346 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 692 (L692P)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: L692P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: L692P

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2199:Xrn2 UTSW 2 147024750 missense probably damaging 0.96
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6297:Xrn2 UTSW 2 147026570 missense probably damaging 1.00
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6316:Xrn2 UTSW 2 147042010 missense probably damaging 1.00
R6705:Xrn2 UTSW 2 147036662 critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
R7856:Xrn2 UTSW 2 147068473 splice site probably null
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAAGTGCTTTTCTTCAGTGTTGTGC -3'
(R):5'- GGTGGCACATCAACTGGCT -3'

Sequencing Primer
(F):5'- CTGCATTAGTCTTAGGGTATAGATGC -3'
(R):5'- GGCAGTCTACTGAGGATTCATACC -3'
Posted On2019-10-07