Incidental Mutation 'R7412:Patj'
ID575132
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98411139 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 166 (E166G)
Ref Sequence ENSEMBL: ENSMUSP00000049176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]
Predicted Effect probably damaging
Transcript: ENSMUST00000041284
AA Change: E166G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: E166G

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107030
AA Change: E166G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859
AA Change: E166G

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107033
AA Change: E166G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: E166G

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107034
AA Change: E166G

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: E166G

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
R8483:Patj UTSW 4 98424302 missense probably damaging 1.00
R8546:Patj UTSW 4 98437397 missense probably benign 0.00
R8844:Patj UTSW 4 98591969 missense probably damaging 1.00
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCGTCAGTTCTGTGGAAAG -3'
(R):5'- TGAGCCCTTCAAAATCAGCAGC -3'

Sequencing Primer
(F):5'- GGTGATATTTAAGTGCACATCATGG -3'
(R):5'- CTTCAAAATCAGCAGCAGGTG -3'
Posted On2019-10-07