Incidental Mutation 'R7412:Skint8'
ID 575133
Institutional Source Beutler Lab
Gene Symbol Skint8
Ensembl Gene ENSMUSG00000078599
Gene Name selection and upkeep of intraepithelial T cells 8
Synonyms OTTMUSG00000009475
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R7412 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 111919392-111950358 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 111928561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 68 (G68D)
Ref Sequence ENSEMBL: ENSMUSP00000133268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106572] [ENSMUST00000165046]
AlphaFold A7XV07
Predicted Effect probably benign
Transcript: ENSMUST00000106572
AA Change: G68D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102182
Gene: ENSMUSG00000078599
AA Change: G68D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
Blast:IG_like 148 231 9e-16 BLAST
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165046
AA Change: G68D

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133268
Gene: ENSMUSG00000078599
AA Change: G68D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Skint8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Skint8 APN 4 111938923 missense probably benign 0.05
IGL01411:Skint8 APN 4 111936906 missense probably damaging 0.97
IGL02973:Skint8 APN 4 111939593 missense probably benign 0.09
IGL03154:Skint8 APN 4 111939510 splice site probably null
FR4976:Skint8 UTSW 4 111938902 missense probably benign 0.02
R0309:Skint8 UTSW 4 111938867 missense probably benign 0.02
R0448:Skint8 UTSW 4 111936890 missense probably damaging 1.00
R0483:Skint8 UTSW 4 111938823 splice site probably benign
R0586:Skint8 UTSW 4 111936929 missense probably damaging 1.00
R1076:Skint8 UTSW 4 111927219 missense probably damaging 1.00
R1169:Skint8 UTSW 4 111928513 missense possibly damaging 0.86
R1588:Skint8 UTSW 4 111928727 nonsense probably null
R1707:Skint8 UTSW 4 111939572 missense probably damaging 1.00
R1865:Skint8 UTSW 4 111936995 missense probably damaging 1.00
R1954:Skint8 UTSW 4 111950081 missense possibly damaging 0.54
R2147:Skint8 UTSW 4 111937077 missense probably damaging 1.00
R2896:Skint8 UTSW 4 111950136 missense probably null
R4945:Skint8 UTSW 4 111939608 missense probably damaging 0.96
R5019:Skint8 UTSW 4 111928648 missense probably damaging 0.99
R5281:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5284:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5289:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5309:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5310:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5588:Skint8 UTSW 4 111936892 missense probably benign 0.01
R5636:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5637:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5638:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5639:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5719:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5720:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5754:Skint8 UTSW 4 111950190 missense probably benign
R5850:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5855:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6036:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6525:Skint8 UTSW 4 111928738 missense probably damaging 0.98
R6554:Skint8 UTSW 4 111927216 missense probably benign 0.35
R6578:Skint8 UTSW 4 111936962 missense probably benign 0.03
R6841:Skint8 UTSW 4 111928771 missense probably damaging 1.00
R7000:Skint8 UTSW 4 111937025 missense probably benign 0.16
R7317:Skint8 UTSW 4 111939520 missense possibly damaging 0.94
R7336:Skint8 UTSW 4 111939572 missense probably benign 0.32
R7480:Skint8 UTSW 4 111928587 nonsense probably null
R8027:Skint8 UTSW 4 111928739 missense probably benign 0.36
R8204:Skint8 UTSW 4 111938893 missense probably benign 0.03
R8963:Skint8 UTSW 4 111937044 missense probably benign 0.03
R9084:Skint8 UTSW 4 111937013 missense probably benign 0.11
R9249:Skint8 UTSW 4 111936962 missense probably damaging 0.98
R9283:Skint8 UTSW 4 111928447 missense probably damaging 0.99
Z1177:Skint8 UTSW 4 111937054 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGTCATGGCATCAGACTTATTTTGG -3'
(R):5'- AACTTACCTGTCACGTTGAGG -3'

Sequencing Primer
(F):5'- CCACAAGACACCTGTTAG -3'
(R):5'- CACGTTGAGGTTCATGATAGCCAC -3'
Posted On 2019-10-07