Incidental Mutation 'R7412:Ap2a2'
ID575153
Institutional Source Beutler Lab
Gene Symbol Ap2a2
Ensembl Gene ENSMUSG00000002957
Gene Nameadaptor-related protein complex 2, alpha 2 subunit
Synonymsalpha-C adaptin, alpha-adaptin C, 2410074K14Rik, Adtab, L25
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141562173-141633011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141626136 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 717 (F717I)
Ref Sequence ENSEMBL: ENSMUSP00000003038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038]
PDB Structure
ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM CLATHRIN ADAPTOR AP2 [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH AMPHIPHYSIN FXDXF [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPSIN DPW PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE IN COMPLEX WITH EPS15 DPF PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AP-2 CLATHRIN ADAPTOR ALPHA-APPENDAGE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ALPHA-ADAPTIN APPENDAGE DOMAIN, FROM THE AP2 ADAPTOR COMPLEX, BOUND TO 2 PEPTIDES FROM SYNAPTOJANIN170 [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE with Dileucine peptide RM(phosphoS)QIKRLLSE [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000003038
AA Change: F717I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957
AA Change: F717I

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Meta Mutation Damage Score 0.6494 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP-2 adaptor protein complex, which is involved in linking lipid and protein membrane components with the clathrin lattice. This interaction supports the formation of clathrin-coated vesicles, and the encoded subunit aids in the process by binding polyphosphoinositide-containing lipids in the cell membrane. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Ap2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ap2a2 APN 7 141605019 splice site probably benign
IGL02664:Ap2a2 APN 7 141629223 missense probably benign 0.00
IGL02973:Ap2a2 APN 7 141631364 missense possibly damaging 0.63
IGL03366:Ap2a2 APN 7 141629273 missense probably benign
R0345:Ap2a2 UTSW 7 141631293 missense probably damaging 1.00
R2212:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R2904:Ap2a2 UTSW 7 141619478 missense probably damaging 0.98
R3412:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R3413:Ap2a2 UTSW 7 141598776 missense probably benign 0.05
R4962:Ap2a2 UTSW 7 141630148 missense probably damaging 1.00
R5602:Ap2a2 UTSW 7 141604942 missense probably benign
R5910:Ap2a2 UTSW 7 141598778 missense probably damaging 1.00
R6488:Ap2a2 UTSW 7 141602307 missense probably benign 0.02
R7003:Ap2a2 UTSW 7 141629196 missense probably benign
R7132:Ap2a2 UTSW 7 141619565 missense probably benign 0.32
R7140:Ap2a2 UTSW 7 141598864 missense probably benign 0.30
R7227:Ap2a2 UTSW 7 141620871 missense probably damaging 1.00
R7482:Ap2a2 UTSW 7 141602297 missense possibly damaging 0.46
R7632:Ap2a2 UTSW 7 141631323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGGTCCCAGACGCTTTTC -3'
(R):5'- GACAGATCTTGAGATGTAAGCTTTG -3'

Sequencing Primer
(F):5'- GTCCCAGACGCTTTTCTGCTTTG -3'
(R):5'- GAAGGTCTCACTATGTAACCTAGGC -3'
Posted On2019-10-07