Incidental Mutation 'R7412:Olfr150'
ID575157
Institutional Source Beutler Lab
Gene Symbol Olfr150
Ensembl Gene ENSMUSG00000094353
Gene Nameolfactory receptor 150
SynonymsGA_x6K02T2PVTD-33434302-33435240, MOR171-18, M93
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39730978-39738456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39737126 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 104 (F104L)
Ref Sequence ENSEMBL: ENSMUSP00000150024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078557] [ENSMUST00000217257]
Predicted Effect probably benign
Transcript: ENSMUST00000078557
AA Change: F104L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077635
Gene: ENSMUSG00000094353
AA Change: F104L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-50 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217257
AA Change: F104L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Olfr150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Olfr150 APN 9 39737499 missense probably damaging 1.00
IGL01110:Olfr150 APN 9 39737397 missense probably benign 0.00
IGL01343:Olfr150 APN 9 39737715 missense probably damaging 0.99
IGL01942:Olfr150 APN 9 39737666 missense possibly damaging 0.90
IGL02044:Olfr150 APN 9 39736974 missense possibly damaging 0.94
PIT4486001:Olfr150 UTSW 9 39737239 nonsense probably null
R1178:Olfr150 UTSW 9 39737346 missense probably damaging 1.00
R1451:Olfr150 UTSW 9 39737316 missense probably benign 0.00
R1672:Olfr150 UTSW 9 39737196 missense probably damaging 1.00
R1916:Olfr150 UTSW 9 39737622 missense probably benign 0.06
R2095:Olfr150 UTSW 9 39737261 missense probably damaging 0.98
R2116:Olfr150 UTSW 9 39737304 missense probably damaging 0.98
R4183:Olfr150 UTSW 9 39737048 missense probably benign 0.01
R4259:Olfr150 UTSW 9 39737703 missense probably damaging 1.00
R4590:Olfr150 UTSW 9 39736850 missense probably damaging 1.00
R5188:Olfr150 UTSW 9 39737235 missense probably benign 0.00
R6158:Olfr150 UTSW 9 39737076 missense probably benign
R6361:Olfr150 UTSW 9 39737672 missense probably damaging 1.00
R6807:Olfr150 UTSW 9 39737618 nonsense probably null
R6977:Olfr150 UTSW 9 39737034 missense probably benign 0.01
R8755:Olfr150 UTSW 9 39737490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTACCTGTTCACAGTGCTGG -3'
(R):5'- CCACTCTTAGCATGCAGAAAGTATG -3'

Sequencing Primer
(F):5'- AACCTGGGCATGATCATCCTG -3'
(R):5'- TGCAGAAAGTATGAATTGCTGCACC -3'
Posted On2019-10-07