Incidental Mutation 'R0626:Naca'
ID57516
Institutional Source Beutler Lab
Gene Symbol Naca
Ensembl Gene ENSMUSG00000061315
Gene Namenascent polypeptide-associated complex alpha polypeptide
SynonymsLOC380777, skNAC
MMRRC Submission 038815-MU
Accession Numbers

Genbank: NM_013608; MGI: 106095 ; Ensembl: ENSMUST00000092048

Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R0626 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128035575-128048637 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 128041162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073868] [ENSMUST00000092048]
Predicted Effect probably benign
Transcript: ENSMUST00000073868
SMART Domains Protein: ENSMUSP00000073532
Gene: ENSMUSG00000061315

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAC 73 130 3.9e-27 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092048
AA Change: T688A
SMART Domains Protein: ENSMUSP00000089680
Gene: ENSMUSG00000061315
AA Change: T688A

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
low complexity region 704 718 N/A INTRINSIC
low complexity region 937 954 N/A INTRINSIC
low complexity region 976 998 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1349 1370 N/A INTRINSIC
low complexity region 1489 1504 N/A INTRINSIC
low complexity region 1572 1593 N/A INTRINSIC
low complexity region 1636 1670 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1806 1827 N/A INTRINSIC
low complexity region 1889 1926 N/A INTRINSIC
low complexity region 1943 1957 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
low complexity region 2016 2029 N/A INTRINSIC
Pfam:NAC 2045 2101 1.7e-25 PFAM
low complexity region 2129 2150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a point mutation exhibit decreased bone volume and bone formation associated with accelerated mineralization and immature woven-bone formation. Mice null for the muscle specific isoform die during organogenesis with cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(156) : Targeted, other(1) Gene trapped(155)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Naca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Naca APN 10 128041682 intron probably benign
IGL00990:Naca APN 10 128043800 intron probably benign
IGL01093:Naca APN 10 128048113 missense probably damaging 0.99
IGL01356:Naca APN 10 128041715 intron probably benign
IGL01548:Naca APN 10 128040904 intron probably benign
IGL02089:Naca APN 10 128036489 splice site probably benign
IGL02148:Naca APN 10 128043884 intron probably benign
IGL02494:Naca APN 10 128041310 intron probably benign
IGL02672:Naca APN 10 128040283 intron probably benign
IGL02822:Naca APN 10 128039345 intron probably benign
IGL02904:Naca APN 10 128043290 intron probably benign
IGL02931:Naca APN 10 128047682 missense probably damaging 1.00
IGL02971:Naca APN 10 128041568 intron probably benign
IGL03104:Naca APN 10 128040364 intron probably benign
Sinewy UTSW 10 128048358 missense probably damaging 1.00
D4216:Naca UTSW 10 128044240 missense possibly damaging 0.73
P0042:Naca UTSW 10 128041553 intron probably benign
R0110:Naca UTSW 10 128044790 missense probably benign 0.13
R0220:Naca UTSW 10 128043386 intron probably benign
R0469:Naca UTSW 10 128044790 missense probably benign 0.13
R0528:Naca UTSW 10 128043293 missense probably benign 0.23
R0594:Naca UTSW 10 128040355 intron probably benign
R0885:Naca UTSW 10 128040179 nonsense probably null
R1129:Naca UTSW 10 128040202 intron probably benign
R1437:Naca UTSW 10 128042179 intron probably benign
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1509:Naca UTSW 10 128043397 intron probably benign
R1561:Naca UTSW 10 128040398 intron probably benign
R1574:Naca UTSW 10 128040398 intron probably benign
R1678:Naca UTSW 10 128043526 intron probably benign
R1901:Naca UTSW 10 128043721 intron probably benign
R2884:Naca UTSW 10 128041678 intron probably benign
R2886:Naca UTSW 10 128041678 intron probably benign
R3176:Naca UTSW 10 128040661 intron probably benign
R3276:Naca UTSW 10 128040661 intron probably benign
R4227:Naca UTSW 10 128041661 intron probably benign
R4388:Naca UTSW 10 128044792 missense probably damaging 0.99
R4402:Naca UTSW 10 128043472 intron probably benign
R4798:Naca UTSW 10 128047803 missense probably null 0.99
R4955:Naca UTSW 10 128042215 intron probably benign
R4996:Naca UTSW 10 128042429 intron probably benign
R5027:Naca UTSW 10 128048121 missense possibly damaging 0.63
R5580:Naca UTSW 10 128040593 intron probably benign
R5752:Naca UTSW 10 128041928 intron probably benign
R5788:Naca UTSW 10 128040142 intron probably benign
R6156:Naca UTSW 10 128039291 intron probably benign
R6227:Naca UTSW 10 128043916 intron probably benign
R6317:Naca UTSW 10 128044124 missense probably benign 0.33
R6665:Naca UTSW 10 128048358 missense probably damaging 1.00
R7170:Naca UTSW 10 128040121 missense unknown
R7247:Naca UTSW 10 128042598 missense unknown
R7632:Naca UTSW 10 128040506 missense unknown
X0053:Naca UTSW 10 128048255 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCATTGTCCCCTGAAATTCCCAAG -3'
(R):5'- GACTGCTGAGATCAGTCTGGAAGC -3'

Sequencing Primer
(F):5'- GAAATTCCCAAGTCTGTGCC -3'
(R):5'- GGAAGAATTTCTGCTGGGACC -3'
Posted On2013-07-11