Incidental Mutation 'R7412:Ganab'
ID575189
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R7412 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8912528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 652 (I652T)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
Predicted Effect probably benign
Transcript: ENSMUST00000096246
AA Change: I652T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: I652T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xpnpep1 G C 19: 53,006,291 A302G probably benign Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0457:Ganab UTSW 19 8907250 missense possibly damaging 0.92
R0551:Ganab UTSW 19 8907280 missense probably benign 0.35
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1427:Ganab UTSW 19 8915666 missense probably benign 0.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R5850:Ganab UTSW 19 8911707 missense probably damaging 1.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 intron probably null
R7284:Ganab UTSW 19 8912540 missense probably damaging 1.00
R7413:Ganab UTSW 19 8904975 missense probably benign 0.01
R7466:Ganab UTSW 19 8914569 nonsense probably null
R7586:Ganab UTSW 19 8911352 missense possibly damaging 0.76
R7657:Ganab UTSW 19 8907357 missense probably damaging 0.99
R7671:Ganab UTSW 19 8912852 missense possibly damaging 0.94
R7729:Ganab UTSW 19 8914712 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGGCCTTTGCTAAGTTCCTAG -3'
(R):5'- TTCTTGAAGAAGCCACCCAC -3'

Sequencing Primer
(F):5'- AAGAGTTGTGTTTAACTTCACTCTC -3'
(R):5'- CACCCACATCCGCTGGG -3'
Posted On2019-10-07