Incidental Mutation 'R7412:Xpnpep1'
ID 575190
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
MMRRC Submission 045493-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7412 (G1)
Quality Score 149.008
Status Validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 52994722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 302 (A302G)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: A302G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: A302G

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: A302G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: A302G

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,448,691 (GRCm39) Y335* probably null Het
Alpk1 A T 3: 127,466,143 (GRCm39) L1121Q probably damaging Het
Alpk1 A G 3: 127,489,382 (GRCm39) I99T probably damaging Het
Ap2a2 T A 7: 141,206,049 (GRCm39) F717I probably damaging Het
Arhgap33 C T 7: 30,222,477 (GRCm39) D1152N probably benign Het
Arvcf A G 16: 18,220,350 (GRCm39) D642G probably benign Het
Astn1 T G 1: 158,329,919 (GRCm39) M258R probably damaging Het
Brinp3 C G 1: 146,777,748 (GRCm39) L732V possibly damaging Het
Carmil1 T C 13: 24,282,793 (GRCm39) D547G possibly damaging Het
Ccdc177 A G 12: 80,805,792 (GRCm39) F161L possibly damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cnot10 A G 9: 114,454,971 (GRCm39) Y221H probably damaging Het
Col6a3 T A 1: 90,755,855 (GRCm39) I145F probably damaging Het
Crybg2 A G 4: 133,801,434 (GRCm39) T865A probably benign Het
Cyp4f37 A G 17: 32,848,818 (GRCm39) S229G possibly damaging Het
Ddx56 G A 11: 6,211,720 (GRCm39) T462I probably damaging Het
Dhx30 T C 9: 109,921,966 (GRCm39) M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Ephb6 A G 6: 41,597,173 (GRCm39) K994E probably damaging Het
Fam83a A C 15: 57,849,821 (GRCm39) T122P probably benign Het
Fbxo24 C A 5: 137,617,885 (GRCm39) C293F possibly damaging Het
Fech A T 18: 64,591,255 (GRCm39) S390T probably benign Het
Fras1 A G 5: 96,762,748 (GRCm39) H750R probably benign Het
Frmpd2 A G 14: 33,293,926 (GRCm39) D1364G probably benign Het
Ganab T C 19: 8,889,892 (GRCm39) I652T probably benign Het
Gm21103 T A 14: 17,482,943 (GRCm39) T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,132,967 (GRCm39) probably benign Het
Gm5799 A G 14: 43,781,995 (GRCm39) I56V possibly damaging Het
Gm7276 T C 18: 77,273,183 (GRCm39) R184G unknown Het
Gmip T G 8: 70,273,149 (GRCm39) D845E probably benign Het
Hspa9 T C 18: 35,082,082 (GRCm39) K175E probably damaging Het
Ipo13 A G 4: 117,752,068 (GRCm39) F890L probably benign Het
Irag1 A T 7: 110,522,963 (GRCm39) V160D probably benign Het
Klrb1f C T 6: 129,033,308 (GRCm39) R179* probably null Het
Nasp A G 4: 116,467,785 (GRCm39) V400A possibly damaging Het
Ncoa7 T A 10: 30,598,847 (GRCm39) K25N possibly damaging Het
Ndrg1 A C 15: 66,832,382 (GRCm39) M1R probably null Het
Nf1 G A 11: 79,364,240 (GRCm39) A1557T probably damaging Het
Nrde2 G A 12: 100,108,509 (GRCm39) Q361* probably null Het
Opn1sw A T 6: 29,379,856 (GRCm39) L126Q probably damaging Het
Or10ak16 A T 4: 118,750,327 (GRCm39) I16F possibly damaging Het
Or1af1 C T 2: 37,109,774 (GRCm39) T91I possibly damaging Het
Or1j4 T C 2: 36,740,478 (GRCm39) L140P probably benign Het
Or5au1 A T 14: 52,273,310 (GRCm39) L86* probably null Het
Or7g17 A T 9: 18,768,085 (GRCm39) I46F possibly damaging Het
Or8g50 T C 9: 39,648,422 (GRCm39) F104L probably benign Het
Osmr A G 15: 6,853,048 (GRCm39) Y616H probably damaging Het
Pagr1a T C 7: 126,615,736 (GRCm39) T120A probably benign Het
Patj A G 4: 98,299,376 (GRCm39) E166G probably damaging Het
Plk4 G A 3: 40,766,613 (GRCm39) V764I probably benign Het
Polr3h G A 15: 81,800,602 (GRCm39) probably null Het
Ptprb T A 10: 116,177,043 (GRCm39) D989E probably benign Het
Sdk2 A T 11: 113,758,909 (GRCm39) probably null Het
Setd1b C A 5: 123,290,639 (GRCm39) R869S unknown Het
Sgcz T C 8: 37,990,565 (GRCm39) I263V probably benign Het
Skint8 G A 4: 111,785,758 (GRCm39) G68D probably benign Het
Slc22a7 A T 17: 46,745,553 (GRCm39) V326E probably benign Het
Slc39a1 T G 3: 90,156,396 (GRCm39) L38R probably damaging Het
Slc4a4 A G 5: 89,362,506 (GRCm39) probably null Het
Sptlc3 A G 2: 139,431,537 (GRCm39) E353G possibly damaging Het
Ssh2 G T 11: 77,340,934 (GRCm39) L695F probably damaging Het
Tacr2 C A 10: 62,097,427 (GRCm39) Y302* probably null Het
Tas2r117 T C 6: 132,780,192 (GRCm39) L110P probably damaging Het
Tex9 A T 9: 72,394,060 (GRCm39) probably null Het
Tmem17 A T 11: 22,468,645 (GRCm39) T195S probably benign Het
Trcg1 T A 9: 57,148,766 (GRCm39) S113T probably benign Het
Trpa1 A T 1: 14,954,422 (GRCm39) F826I probably benign Het
Usp17lc A G 7: 103,067,575 (GRCm39) Y290C probably damaging Het
Vmn2r32 T A 7: 7,477,212 (GRCm39) D393V possibly damaging Het
Wdfy4 A G 14: 32,871,541 (GRCm39) L290P Het
Xrn2 T C 2: 146,891,266 (GRCm39) L692P probably damaging Het
Zgrf1 A G 3: 127,356,720 (GRCm39) S649G probably benign Het
Zscan4b C T 7: 10,634,791 (GRCm39) C484Y probably damaging Het
Zscan4b T C 7: 10,635,820 (GRCm39) D169G probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 52,994,769 (GRCm39) missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 52,998,564 (GRCm39) missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53,003,053 (GRCm39) missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 52,998,538 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 52,993,248 (GRCm39) missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53,020,491 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAGCCCAGATCTCTGTTTCAGC -3'
(R):5'- AAAGGAACAGCGTGTCCTC -3'

Sequencing Primer
(F):5'- TTTCAGCTCTTTACAACATCAGAACC -3'
(R):5'- AGGAACAGCGTGTCCTCCTTTG -3'
Posted On 2019-10-07