Incidental Mutation 'R7412:Xpnpep1'
ID575190
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene NameX-prolyl aminopeptidase (aminopeptidase P) 1, soluble
SynonymsD230045I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7412 (G1)
Quality Score149.008
Status Validated
Chromosome19
Chromosomal Location52943417-53040214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 53006291 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 302 (A302G)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: A302G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: A302G

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: A302G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: A302G

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,829 Y335* probably null Het
Alpk1 A T 3: 127,672,494 L1121Q probably damaging Het
Alpk1 A G 3: 127,695,733 I99T probably damaging Het
Ap2a2 T A 7: 141,626,136 F717I probably damaging Het
Arhgap33 C T 7: 30,523,052 D1152N probably benign Het
Arvcf A G 16: 18,401,600 D642G probably benign Het
Astn1 T G 1: 158,502,349 M258R probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Carmil1 T C 13: 24,098,810 D547G possibly damaging Het
Ccdc177 A G 12: 80,759,018 F161L possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cnot10 A G 9: 114,625,903 Y221H probably damaging Het
Col6a3 T A 1: 90,828,133 I145F probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp4f37 A G 17: 32,629,844 S229G possibly damaging Het
Ddx56 G A 11: 6,261,720 T462I probably damaging Het
Dhx30 T C 9: 110,092,898 M239V probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephb6 A G 6: 41,620,239 K994E probably damaging Het
Fam83a A C 15: 57,986,425 T122P probably benign Het
Fbxo24 C A 5: 137,619,623 C293F possibly damaging Het
Fech A T 18: 64,458,184 S390T probably benign Het
Fras1 A G 5: 96,614,889 H750R probably benign Het
Frmpd2 A G 14: 33,571,969 D1364G probably benign Het
Ganab T C 19: 8,912,528 I652T probably benign Het
Gm21103 T A 14: 6,301,955 T153S probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGTTAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG GGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAG 18: 80,089,752 probably benign Het
Gm5799 A G 14: 43,544,538 I56V possibly damaging Het
Gm7276 T C 18: 77,185,487 R184G unknown Het
Gmip T G 8: 69,820,499 D845E probably benign Het
Hspa9 T C 18: 34,949,029 K175E probably damaging Het
Ipo13 A G 4: 117,894,871 F890L probably benign Het
Klrb1f C T 6: 129,056,345 R179* probably null Het
Mrvi1 A T 7: 110,923,756 V160D probably benign Het
Nasp A G 4: 116,610,588 V400A possibly damaging Het
Ncoa7 T A 10: 30,722,851 K25N possibly damaging Het
Ndrg1 A C 15: 66,960,533 M1R probably null Het
Nf1 G A 11: 79,473,414 A1557T probably damaging Het
Nrde2 G A 12: 100,142,250 Q361* probably null Het
Olfr1330 A T 4: 118,893,130 I16F possibly damaging Het
Olfr150 T C 9: 39,737,126 F104L probably benign Het
Olfr221 A T 14: 52,035,853 L86* probably null Het
Olfr350 T C 2: 36,850,466 L140P probably benign Het
Olfr366 C T 2: 37,219,762 T91I possibly damaging Het
Olfr829 A T 9: 18,856,789 I46F possibly damaging Het
Opn1sw A T 6: 29,379,857 L126Q probably damaging Het
Osmr A G 15: 6,823,567 Y616H probably damaging Het
Pagr1a T C 7: 127,016,564 T120A probably benign Het
Patj A G 4: 98,411,139 E166G probably damaging Het
Plk4 G A 3: 40,812,178 V764I probably benign Het
Polr3h G A 15: 81,916,401 probably null Het
Ptprb T A 10: 116,341,138 D989E probably benign Het
Sdk2 A T 11: 113,868,083 probably null Het
Setd1b C A 5: 123,152,576 R869S unknown Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Skint8 G A 4: 111,928,561 G68D probably benign Het
Slc22a7 A T 17: 46,434,627 V326E probably benign Het
Slc39a1 T G 3: 90,249,089 L38R probably damaging Het
Slc4a4 A G 5: 89,214,647 probably null Het
Sptlc3 A G 2: 139,589,617 E353G possibly damaging Het
Ssh2 G T 11: 77,450,108 L695F probably damaging Het
Tacr2 C A 10: 62,261,648 Y302* probably null Het
Tas2r117 T C 6: 132,803,229 L110P probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tmem17 A T 11: 22,518,645 T195S probably benign Het
Trcg1 T A 9: 57,241,483 S113T probably benign Het
Trpa1 A T 1: 14,884,198 F826I probably benign Het
Usp17lc A G 7: 103,418,368 Y290C probably damaging Het
Vmn2r32 T A 7: 7,474,213 D393V possibly damaging Het
Wdfy4 A G 14: 33,149,584 L290P Het
Xrn2 T C 2: 147,049,346 L692P probably damaging Het
Zgrf1 A G 3: 127,563,071 S649G probably benign Het
Zscan4b C T 7: 10,900,864 C484Y probably damaging Het
Zscan4b T C 7: 10,901,893 D169G probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R8329:Xpnpep1 UTSW 19 53002472 critical splice donor site probably null
RF017:Xpnpep1 UTSW 19 53032060 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAGCCCAGATCTCTGTTTCAGC -3'
(R):5'- AAAGGAACAGCGTGTCCTC -3'

Sequencing Primer
(F):5'- TTTCAGCTCTTTACAACATCAGAACC -3'
(R):5'- AGGAACAGCGTGTCCTCCTTTG -3'
Posted On2019-10-07