Incidental Mutation 'R7413:Dpp4'
ID575194
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62356989 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 474 (Y474C)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably damaging
Transcript: ENSMUST00000047812
AA Change: Y474C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: Y474C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Mdga1 A T 17: 29,850,673 V133E probably damaging Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Meis1 T A 11: 18,988,357 D218V probably damaging Het
Myo15b A G 11: 115,878,144 E1439G Het
Nckipsd G A 9: 108,814,081 V401I probably benign Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Selenbp2 A G 3: 94,700,097 Q275R probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Ttc39c A G 18: 12,728,689 K416R possibly damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R0581:Dpp4 UTSW 2 62356676 missense probably benign
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R3765:Dpp4 UTSW 2 62386436 missense probably benign 0.17
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5173:Dpp4 UTSW 2 62387130 missense probably damaging 1.00
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7366:Dpp4 UTSW 2 62354599 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8004:Dpp4 UTSW 2 62358828 missense probably benign 0.00
R8197:Dpp4 UTSW 2 62372827 missense probably benign 0.31
R8341:Dpp4 UTSW 2 62347890 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CATGCGACAACAGTGAGCAG -3'
(R):5'- GAACGCATCCTACACTTAATTGC -3'

Sequencing Primer
(F):5'- TGGGCCGTGCACACTTC -3'
(R):5'- AGAGCTGAGCTTCTTACC -3'
Posted On2019-10-07