Incidental Mutation 'R0626:Dnah2'
ID57520
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0626 (G1)
Quality Score187
Status Not validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69477683 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1709 (S1709T)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably benign
Transcript: ENSMUST00000035539
AA Change: S1709T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: S1709T

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108659
AA Change: S1709T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: S1709T

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 intron probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 utr 5 prime probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7793:Dnah2 UTSW 11 69495214 missense probably benign 0.00
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTAACTCTGCTCTGCATGGTG -3'
(R):5'- GGCCCTCAAGAAGTTCCTCAACAAG -3'

Sequencing Primer
(F):5'- CAGCTCATCTCCAGTTGTGA -3'
(R):5'- GAGGCTCTCAAACAGAGGCTC -3'
Posted On2013-07-11