Incidental Mutation 'R7413:Selenbp2'
ID575201
Institutional Source Beutler Lab
Gene Symbol Selenbp2
Ensembl Gene ENSMUSG00000068877
Gene Nameselenium binding protein 2
SynonymsAP56, Lpsb2, acetaminophen-binding protein
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94693556-94704413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94700097 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 275 (Q275R)
Ref Sequence ENSEMBL: ENSMUSP00000088358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090848] [ENSMUST00000131650] [ENSMUST00000173849] [ENSMUST00000173981] [ENSMUST00000174223]
Predicted Effect probably benign
Transcript: ENSMUST00000090848
AA Change: Q275R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000088358
Gene: ENSMUSG00000068877
AA Change: Q275R

DomainStartEndE-ValueType
Pfam:SBP56 6 472 7.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131650
Predicted Effect probably benign
Transcript: ENSMUST00000173849
AA Change: Q213R

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134270
Gene: ENSMUSG00000068877
AA Change: Q213R

DomainStartEndE-ValueType
Pfam:SBP56 6 62 4.4e-22 PFAM
Pfam:SBP56 57 410 4.1e-165 PFAM
Pfam:Lactonase 163 296 4.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173981
SMART Domains Protein: ENSMUSP00000133320
Gene: ENSMUSG00000068877

DomainStartEndE-ValueType
Pfam:SBP56 1 128 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174223
SMART Domains Protein: ENSMUSP00000134623
Gene: ENSMUSG00000068877

DomainStartEndE-ValueType
Pfam:SBP56 6 134 3.1e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Dpp4 T C 2: 62,356,989 Y474C probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Mdga1 A T 17: 29,850,673 V133E probably damaging Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Meis1 T A 11: 18,988,357 D218V probably damaging Het
Myo15b A G 11: 115,878,144 E1439G Het
Nckipsd G A 9: 108,814,081 V401I probably benign Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Ttc39c A G 18: 12,728,689 K416R possibly damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in Selenbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Selenbp2 APN 3 94698144 missense possibly damaging 0.76
IGL02007:Selenbp2 APN 3 94698154 missense possibly damaging 0.67
IGL02103:Selenbp2 APN 3 94698131 missense probably null
IGL02222:Selenbp2 APN 3 94699962 missense probably damaging 1.00
IGL02441:Selenbp2 APN 3 94704064 missense probably benign 0.02
IGL03086:Selenbp2 APN 3 94699638 missense probably damaging 1.00
R0068:Selenbp2 UTSW 3 94703509 missense probably benign 0.00
R0256:Selenbp2 UTSW 3 94699701 missense probably benign 0.35
R0725:Selenbp2 UTSW 3 94697502 splice site probably benign
R0879:Selenbp2 UTSW 3 94699556 missense possibly damaging 0.76
R1636:Selenbp2 UTSW 3 94696815 missense probably damaging 1.00
R3719:Selenbp2 UTSW 3 94699617 missense probably damaging 1.00
R4828:Selenbp2 UTSW 3 94704119 missense probably benign 0.27
R4962:Selenbp2 UTSW 3 94703549 missense probably damaging 0.99
R6661:Selenbp2 UTSW 3 94702514 missense probably damaging 1.00
R7201:Selenbp2 UTSW 3 94702357 missense probably benign 0.03
R7221:Selenbp2 UTSW 3 94703826 nonsense probably null
X0050:Selenbp2 UTSW 3 94704128 missense probably damaging 0.99
Z1176:Selenbp2 UTSW 3 94698100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGATCTGCTCAGGAG -3'
(R):5'- CTAGCCTCAGACCTATGAGCTAC -3'

Sequencing Primer
(F):5'- AGATCTGCTCAGGAGTCCTCTG -3'
(R):5'- TCAGACCTATGAGCTACATAAACCTC -3'
Posted On2019-10-07