Incidental Mutation 'R7413:Nckipsd'
ID 575224
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R7413 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108691280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 401 (V401I)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect probably benign
Transcript: ENSMUST00000035218
AA Change: V401I

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: V401I

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,895,524 (GRCm39) probably null Het
Agbl4 A T 4: 111,514,495 (GRCm39) D502V probably benign Het
Akap5 T A 12: 76,375,678 (GRCm39) V370E possibly damaging Het
Alms1 T C 6: 85,605,288 (GRCm39) C1844R probably benign Het
Apaf1 T C 10: 90,831,542 (GRCm39) K1191E probably benign Het
Bsn C T 9: 108,016,690 (GRCm39) R107Q possibly damaging Het
Catsperb G T 12: 101,447,307 (GRCm39) R269L probably damaging Het
Ccer1 T C 10: 97,529,804 (GRCm39) S156P unknown Het
Cdh16 C T 8: 105,346,572 (GRCm39) A241T probably benign Het
Cdk5rap2 A G 4: 70,172,972 (GRCm39) S1367P probably damaging Het
Cds2 C T 2: 132,135,235 (GRCm39) P42L probably benign Het
Col15a1 T C 4: 47,245,431 (GRCm39) Y61H possibly damaging Het
Dclre1a G A 19: 56,531,082 (GRCm39) P755S probably damaging Het
Ddi1 A T 9: 6,265,670 (GRCm39) M233K probably damaging Het
Dpp4 T C 2: 62,187,333 (GRCm39) Y474C probably damaging Het
Epha7 T A 4: 28,871,838 (GRCm39) M389K probably benign Het
Ephb3 T C 16: 21,033,457 (GRCm39) F181S probably damaging Het
Epor G A 9: 21,874,776 (GRCm39) probably benign Het
Fbp2 C A 13: 62,985,067 (GRCm39) V285L probably benign Het
Flnc A T 6: 29,452,258 (GRCm39) D1694V probably damaging Het
Ganab T A 19: 8,882,339 (GRCm39) M98K probably benign Het
Gcm2 A G 13: 41,259,230 (GRCm39) S80P probably damaging Het
Gls A G 1: 52,254,735 (GRCm39) S247P probably benign Het
Gne T C 4: 44,044,857 (GRCm39) N426D probably benign Het
Ifne A T 4: 88,797,840 (GRCm39) *193R probably null Het
Igf2r G T 17: 12,917,115 (GRCm39) S1595* probably null Het
Krt26 C T 11: 99,225,887 (GRCm39) M226I probably benign Het
Lars2 G A 9: 123,288,568 (GRCm39) V805I probably benign Het
Lrrc57 C A 2: 120,436,577 (GRCm39) R177L probably damaging Het
Lrrn1 A G 6: 107,546,083 (GRCm39) E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,027,592 (GRCm39) probably benign Het
Mdga1 A T 17: 30,069,647 (GRCm39) V133E probably damaging Het
Med12l A G 3: 58,998,971 (GRCm39) T644A probably benign Het
Meis1 T A 11: 18,938,357 (GRCm39) D218V probably damaging Het
Myo15b A G 11: 115,768,970 (GRCm39) E1439G Het
Naa12 T C 18: 80,254,874 (GRCm39) V56A possibly damaging Het
Nrg3 T C 14: 38,092,669 (GRCm39) I655V probably damaging Het
Oprm1 A T 10: 6,778,919 (GRCm39) I107F probably damaging Het
Or4k42 A C 2: 111,319,933 (GRCm39) I190R probably benign Het
Or52n3 A T 7: 104,530,057 (GRCm39) I48F probably benign Het
Or5p51 T C 7: 107,444,721 (GRCm39) D73G probably damaging Het
Osbpl7 T C 11: 96,945,704 (GRCm39) probably null Het
Pcdh18 T G 3: 49,699,232 (GRCm39) S1077R possibly damaging Het
Pcdhb16 A T 18: 37,611,975 (GRCm39) K312* probably null Het
Plekhh2 A T 17: 84,873,724 (GRCm39) E336D probably benign Het
Ptprd A T 4: 76,165,076 (GRCm39) S49T probably benign Het
Pxdn A G 12: 30,052,927 (GRCm39) I1035V probably benign Het
Rlf C T 4: 121,007,297 (GRCm39) G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,128 (GRCm39) probably benign Het
Selenbp2 A G 3: 94,607,404 (GRCm39) Q275R probably benign Het
Slc10a1 G T 12: 81,007,396 (GRCm39) F128L probably benign Het
Slitrk1 A T 14: 109,149,357 (GRCm39) Y451* probably null Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Stambpl1 G C 19: 34,204,116 (GRCm39) G69R probably damaging Het
Surf4 G T 2: 26,814,455 (GRCm39) R149S probably benign Het
Tmem151a T C 19: 5,132,702 (GRCm39) Y168C probably damaging Het
Ttc39c A G 18: 12,861,746 (GRCm39) K416R possibly damaging Het
Tut4 T C 4: 108,406,533 (GRCm39) I1367T possibly damaging Het
Vit T C 17: 78,932,309 (GRCm39) I472T probably damaging Het
Vmn1r212 A C 13: 23,067,718 (GRCm39) L205R probably damaging Het
Wscd2 T C 5: 113,715,402 (GRCm39) I414T probably benign Het
Zfp1005 A C 2: 150,108,081 (GRCm39) T14P possibly damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6144:Nckipsd UTSW 9 108,689,585 (GRCm39) missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7676:Nckipsd UTSW 9 108,692,153 (GRCm39) missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108,691,216 (GRCm39) nonsense probably null
R7893:Nckipsd UTSW 9 108,692,588 (GRCm39) missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108,692,127 (GRCm39) missense probably benign 0.10
R9327:Nckipsd UTSW 9 108,691,699 (GRCm39) missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATGCTAAGCTTAGAGGGGC -3'
(R):5'- GCAAACTTCGGGATCTGCATC -3'

Sequencing Primer
(F):5'- CTAAGCTTAGAGGGGCCAGGTC -3'
(R):5'- GGATCTGCATCCGTCTGG -3'
Posted On 2019-10-07