Incidental Mutation 'R7413:Nckipsd'
ID575224
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene NameNCK interacting protein with SH3 domain
SynonymsAF3P21, Wasbp, SPIN90, DIP1, WISH, ORF1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108808368-108818844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108814081 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 401 (V401I)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably benign
Transcript: ENSMUST00000035218
AA Change: V401I

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: V401I

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Dpp4 T C 2: 62,356,989 Y474C probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Mdga1 A T 17: 29,850,673 V133E probably damaging Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Meis1 T A 11: 18,988,357 D218V probably damaging Het
Myo15b A G 11: 115,878,144 E1439G Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Selenbp2 A G 3: 94,700,097 Q275R probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Ttc39c A G 18: 12,728,689 K416R possibly damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108814969 missense probably benign 0.07
IGL01601:Nckipsd APN 9 108813955 missense probably benign 0.00
IGL01809:Nckipsd APN 9 108817554 missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108811614 missense probably benign
R0714:Nckipsd UTSW 9 108814134 unclassified probably benign
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108812372 missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108814664 splice site probably null
R2127:Nckipsd UTSW 9 108811733 missense probably benign
R3697:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108814076 missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108814739 missense probably benign 0.28
R4879:Nckipsd UTSW 9 108813915 unclassified probably benign
R5796:Nckipsd UTSW 9 108811614 missense probably benign
R5891:Nckipsd UTSW 9 108808609 missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108812236 missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108813977 missense probably benign 0.00
R6144:Nckipsd UTSW 9 108812386 missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108811683 missense possibly damaging 0.71
R7676:Nckipsd UTSW 9 108814954 missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108814017 nonsense probably null
R7893:Nckipsd UTSW 9 108815389 missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108814928 missense probably benign 0.10
Y4335:Nckipsd UTSW 9 108817545 missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108814677 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATGCTAAGCTTAGAGGGGC -3'
(R):5'- GCAAACTTCGGGATCTGCATC -3'

Sequencing Primer
(F):5'- CTAAGCTTAGAGGGGCCAGGTC -3'
(R):5'- GGATCTGCATCCGTCTGG -3'
Posted On2019-10-07