Incidental Mutation 'R7413:Meis1'
ID575229
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18988357 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 218 (D218V)
Ref Sequence ENSEMBL: ENSMUSP00000139219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect probably benign
Transcript: ENSMUST00000068264
AA Change: D218V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160
AA Change: D218V

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102878
AA Change: D218V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160
AA Change: D218V

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000144988
AA Change: D218V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160
AA Change: D218V

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000177417
AA Change: D218V

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160
AA Change: D218V

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185131
AA Change: D218V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: D218V

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Dpp4 T C 2: 62,356,989 Y474C probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Mdga1 A T 17: 29,850,673 V133E probably damaging Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Myo15b A G 11: 115,878,144 E1439G Het
Nckipsd G A 9: 108,814,081 V401I probably benign Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Selenbp2 A G 3: 94,700,097 Q275R probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Ttc39c A G 18: 12,728,689 K416R possibly damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1477:Meis1 UTSW 11 18881665 nonsense probably null
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2342:Meis1 UTSW 11 18881647 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R3078:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5506:Meis1 UTSW 11 18941747 missense possibly damaging 0.52
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 splice site probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R6624:Meis1 UTSW 11 19016215 missense probably benign
R7292:Meis1 UTSW 11 19011351 missense probably damaging 1.00
R7434:Meis1 UTSW 11 18885542 missense unknown
R7571:Meis1 UTSW 11 18941702 missense probably damaging 1.00
R8719:Meis1 UTSW 11 18885587 missense probably benign
Z1176:Meis1 UTSW 11 19014317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTATGCTGTCAGAGAAGCTCTATG -3'
(R):5'- ATCTGGGAGCTGAAATTGGC -3'

Sequencing Primer
(F):5'- AGAACACCTCTCCTACCTTG -3'
(R):5'- GGAGCTGAAATTGGCAGTTTTTCAAC -3'
Posted On2019-10-07