Mutagenetix > Incidental Mutations

Incidental Mutation 'R7413:Igf2r'

575243

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene?

Probably essential (E-score: 0.925) question?

Stock #

R7413 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 12698228 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 1595 (S1595*)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

Predicted Effect

probably null
Transcript: ENSMUST00000024599
AA Change: S1595*

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: S1595*

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	T	C	19: 31,918,124		probably null	Het
Agbl4	A	T	4: 111,657,298	D502V	probably benign	Het
Akap5	T	A	12: 76,328,904	V370E	possibly damaging	Het
Alms1	T	C	6: 85,628,306	C1844R	probably benign	Het
Apaf1	T	C	10: 90,995,680	K1191E	probably benign	Het
Bsn	C	T	9: 108,139,491	R107Q	possibly damaging	Het
Catsperb	G	T	12: 101,481,048	R269L	probably damaging	Het
Ccer1	T	C	10: 97,693,942	S156P	unknown	Het
Cdh16	C	T	8: 104,619,940	A241T	probably benign	Het
Cdk5rap2	A	G	4: 70,254,735	S1367P	probably damaging	Het
Cds2	C	T	2: 132,293,315	P42L	probably benign	Het
Col15a1	T	C	4: 47,245,431	Y61H	possibly damaging	Het
Dclre1a	G	A	19: 56,542,650	P755S	probably damaging	Het
Ddi1	A	T	9: 6,265,670	M233K	probably damaging	Het
Dpp4	T	C	2: 62,356,989	Y474C	probably damaging	Het
Epha7	T	A	4: 28,871,838	M389K	probably benign	Het
Ephb3	T	C	16: 21,214,707	F181S	probably damaging	Het
Epor	G	A	9: 21,963,480		probably benign	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Fbp2	C	A	13: 62,837,253	V285L	probably benign	Het
Flnc	A	T	6: 29,452,259	D1694V	probably damaging	Het
Ganab	T	A	19: 8,904,975	M98K	probably benign	Het
Gcm2	A	G	13: 41,105,754	S80P	probably damaging	Het
Gls	A	G	1: 52,215,576	S247P	probably benign	Het
Gm14124	A	C	2: 150,266,161	T14P	possibly damaging	Het
Gm16286	T	C	18: 80,211,659	V56A	possibly damaging	Het
Gne	T	C	4: 44,044,857	N426D	probably benign	Het
Ifne	A	T	4: 88,879,603	*193R	probably null	Het
Krt26	C	T	11: 99,335,061	M226I	probably benign	Het
Lars2	G	A	9: 123,459,503	V805I	probably benign	Het
Lrrc57	C	A	2: 120,606,096	R177L	probably damaging	Het
Lrrn1	A	G	6: 107,569,122	E627G	probably benign	Het
Magel2	CCCTCCTCCTCCTCCTCCTCCT	CCCTCCTCCTCCTCCTCCT	7: 62,377,844		probably benign	Het
Mdga1	A	T	17: 29,850,673	V133E	probably damaging	Het
Med12l	A	G	3: 59,091,550	T644A	probably benign	Het
Meis1	T	A	11: 18,988,357	D218V	probably damaging	Het
Myo15b	A	G	11: 115,878,144	E1439G		Het
Nckipsd	G	A	9: 108,814,081	V401I	probably benign	Het
Nrg3	T	C	14: 38,370,712	I655V	probably damaging	Het
Olfr1290	A	C	2: 111,489,588	I190R	probably benign	Het
Olfr470	T	C	7: 107,845,514	D73G	probably damaging	Het
Olfr665	A	T	7: 104,880,850	I48F	probably benign	Het
Oprm1	A	T	10: 6,828,919	I107F	probably damaging	Het
Osbpl7	T	C	11: 97,054,878		probably null	Het
Pcdh18	T	G	3: 49,744,783	S1077R	possibly damaging	Het
Pcdhb16	A	T	18: 37,478,922	K312*	probably null	Het
Plekhh2	A	T	17: 84,566,296	E336D	probably benign	Het
Ptprd	A	T	4: 76,246,839	S49T	probably benign	Het
Pxdn	A	G	12: 30,002,928	I1035V	probably benign	Het
Rlf	C	T	4: 121,150,100	G671D	probably damaging	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,921		probably benign	Het
Selenbp2	A	G	3: 94,700,097	Q275R	probably benign	Het
Slc10a1	G	T	12: 80,960,622	F128L	probably benign	Het
Slitrk1	A	T	14: 108,911,925	Y451*	probably null	Het
Stambpl1	G	C	19: 34,226,716	G69R	probably damaging	Het
Surf4	G	T	2: 26,924,443	R149S	probably benign	Het
Tmem151a	T	C	19: 5,082,674	Y168C	probably damaging	Het
Ttc39c	A	G	18: 12,728,689	K416R	possibly damaging	Het
Vit	T	C	17: 78,624,880	I472T	probably damaging	Het
Vmn1r212	A	C	13: 22,883,548	L205R	probably damaging	Het
Wscd2	T	C	5: 113,577,341	I414T	probably benign	Het
Zcchc11	T	C	4: 108,549,336	I1367T	possibly damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGGACTGCTAGGAACCAGC -3'
(R):5'- TTAGGAGACACTGCGTTCTTCTG -3'

Sequencing Primer
(F):5'- TGCTAGGAACCAGCAAACTG -3'
(R):5'- CACTGCGTTCTTCTGTGAAATTAATC -3'

Posted On

2019-10-07