Incidental Mutation 'R7413:Mdga1'
ID575244
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location29827956-29970087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29850673 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 133 (V133E)
Ref Sequence ENSEMBL: ENSMUSP00000132583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000165211] [ENSMUST00000167190] [ENSMUST00000171691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073556
AA Change: V133E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: V133E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165211
AA Change: V133E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132583
Gene: ENSMUSG00000043557
AA Change: V133E

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG_like 148 221 6.07e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167190
AA Change: V407E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: V407E

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171691
AA Change: V133E

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: V133E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Dpp4 T C 2: 62,356,989 Y474C probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Meis1 T A 11: 18,988,357 D218V probably damaging Het
Myo15b A G 11: 115,878,144 E1439G Het
Nckipsd G A 9: 108,814,081 V401I probably benign Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Selenbp2 A G 3: 94,700,097 Q275R probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Ttc39c A G 18: 12,728,689 K416R possibly damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 29843127 missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 29839871 missense probably damaging 1.00
IGL02130:Mdga1 APN 17 29857669 missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 29832405 splice site probably benign
IGL03258:Mdga1 APN 17 29839913 missense probably damaging 1.00
R0184:Mdga1 UTSW 17 29852442 missense probably damaging 1.00
R0366:Mdga1 UTSW 17 29857708 missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 29850548 missense probably damaging 0.98
R1520:Mdga1 UTSW 17 29846519 missense probably benign 0.12
R1545:Mdga1 UTSW 17 29842902 missense probably damaging 1.00
R1549:Mdga1 UTSW 17 29837998 missense probably damaging 1.00
R1671:Mdga1 UTSW 17 29850629 missense probably damaging 1.00
R1875:Mdga1 UTSW 17 29852607 missense probably damaging 1.00
R1893:Mdga1 UTSW 17 29849226 missense probably damaging 1.00
R1958:Mdga1 UTSW 17 29840888 missense probably damaging 1.00
R1983:Mdga1 UTSW 17 29850605 missense probably damaging 1.00
R2014:Mdga1 UTSW 17 29849313 missense probably damaging 1.00
R2894:Mdga1 UTSW 17 29852504 missense probably damaging 1.00
R2964:Mdga1 UTSW 17 29852468 missense probably damaging 1.00
R3813:Mdga1 UTSW 17 29838479 missense probably damaging 1.00
R3938:Mdga1 UTSW 17 29857622 missense probably damaging 1.00
R3982:Mdga1 UTSW 17 29931264 missense unknown
R4063:Mdga1 UTSW 17 29838031 missense probably damaging 1.00
R4157:Mdga1 UTSW 17 29833343 missense probably benign 0.32
R4183:Mdga1 UTSW 17 29969990 missense unknown
R4392:Mdga1 UTSW 17 29850656 missense probably damaging 1.00
R4393:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4396:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4806:Mdga1 UTSW 17 29842154 missense probably benign 0.20
R4829:Mdga1 UTSW 17 29846369 missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 29838078 missense probably damaging 0.99
R4932:Mdga1 UTSW 17 29857606 missense probably damaging 1.00
R5015:Mdga1 UTSW 17 29839873 missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 29850554 missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 29852493 missense probably benign 0.43
R5180:Mdga1 UTSW 17 29857736 splice site probably benign
R5590:Mdga1 UTSW 17 29839867 missense probably damaging 1.00
R5747:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R5748:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R6207:Mdga1 UTSW 17 29838517 missense probably damaging 1.00
R6826:Mdga1 UTSW 17 29970026 missense unknown
R6831:Mdga1 UTSW 17 29887516 nonsense probably null
R7114:Mdga1 UTSW 17 29842842 splice site probably null
R7147:Mdga1 UTSW 17 29846521 nonsense probably null
R7273:Mdga1 UTSW 17 29969938 missense unknown
R7637:Mdga1 UTSW 17 29832379 missense probably benign 0.00
R7797:Mdga1 UTSW 17 29842840 splice site probably null
R7812:Mdga1 UTSW 17 29843141 missense probably benign 0.02
R7838:Mdga1 UTSW 17 29839822 missense probably benign 0.10
R8463:Mdga1 UTSW 17 29849729 missense probably damaging 1.00
R8697:Mdga1 UTSW 17 29846641 missense probably damaging 0.97
R8699:Mdga1 UTSW 17 29842374 missense possibly damaging 0.87
R8864:Mdga1 UTSW 17 29931321 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCCTGACCTGAGTATAGAGAG -3'
(R):5'- GATAGGGAGCCTGGAAGTCATC -3'

Sequencing Primer
(F):5'- AGAGGCTCGTAGATGTCAACCC -3'
(R):5'- CTGGAAGTCATCGGATCCAGTTC -3'
Posted On2019-10-07