Incidental Mutation 'R7413:Ttc39c'
ID575247
Institutional Source Beutler Lab
Gene Symbol Ttc39c
Ensembl Gene ENSMUSG00000024424
Gene Nametetratricopeptide repeat domain 39C
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12599926-12737050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12728689 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 416 (K416R)
Ref Sequence ENSEMBL: ENSMUSP00000025294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025294] [ENSMUST00000169401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025294
AA Change: K416R

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025294
Gene: ENSMUSG00000024424
AA Change: K416R

DomainStartEndE-ValueType
Pfam:DUF3808 31 495 7.3e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169401
AA Change: K358R

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133127
Gene: ENSMUSG00000024424
AA Change: K358R

DomainStartEndE-ValueType
Pfam:DUF3808 1 437 1.6e-134 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Dpp4 T C 2: 62,356,989 Y474C probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Mdga1 A T 17: 29,850,673 V133E probably damaging Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Meis1 T A 11: 18,988,357 D218V probably damaging Het
Myo15b A G 11: 115,878,144 E1439G Het
Nckipsd G A 9: 108,814,081 V401I probably benign Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Selenbp2 A G 3: 94,700,097 Q275R probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in Ttc39c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Ttc39c APN 18 12684895 splice site probably benign
IGL02323:Ttc39c APN 18 12736743 missense probably null 0.79
R1628:Ttc39c UTSW 18 12734879 splice site probably benign
R1771:Ttc39c UTSW 18 12684824 splice site probably null
R2002:Ttc39c UTSW 18 12697878 splice site probably null
R4162:Ttc39c UTSW 18 12724937 critical splice acceptor site probably null
R4344:Ttc39c UTSW 18 12728610 splice site probably null
R4484:Ttc39c UTSW 18 12730069 missense possibly damaging 0.90
R4752:Ttc39c UTSW 18 12728725 missense probably benign 0.05
R4872:Ttc39c UTSW 18 12687116 intron probably benign
R4912:Ttc39c UTSW 18 12734894 missense probably benign 0.00
R4946:Ttc39c UTSW 18 12724942 nonsense probably null
R5036:Ttc39c UTSW 18 12687081 critical splice donor site probably null
R5439:Ttc39c UTSW 18 12695371 missense possibly damaging 0.88
R5726:Ttc39c UTSW 18 12697935 missense probably damaging 1.00
R7213:Ttc39c UTSW 18 12687081 critical splice donor site probably null
R7400:Ttc39c UTSW 18 12643799 intron probably benign
R7567:Ttc39c UTSW 18 12689879 missense probably benign 0.01
R7979:Ttc39c UTSW 18 12732965 missense probably benign
R8769:Ttc39c UTSW 18 12695488 missense probably damaging 1.00
R8827:Ttc39c UTSW 18 12695379 missense probably benign
R8855:Ttc39c UTSW 18 12697946 missense probably benign 0.30
R8866:Ttc39c UTSW 18 12697946 missense probably benign 0.30
Z1088:Ttc39c UTSW 18 12686963 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGTGTGGTTCTCATCAGC -3'
(R):5'- AAATCAACCCTGCTGTAGCC -3'

Sequencing Primer
(F):5'- CTGAGAGCTGTACATTGTACCCAG -3'
(R):5'- GCATGGCTGATAAGCTCT -3'
Posted On2019-10-07