Incidental Mutation 'R7413:A1cf'
ID575252
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene NameAPOBEC1 complementation factor
Synonymsapobec-1 complementation factor, ACF, 1810073H04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7413 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location31868764-31948573 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31918124 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]
Predicted Effect probably null
Transcript: ENSMUST00000075838
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224304
Predicted Effect probably null
Transcript: ENSMUST00000224400
Predicted Effect probably null
Transcript: ENSMUST00000224564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224809
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A T 4: 111,657,298 D502V probably benign Het
Akap5 T A 12: 76,328,904 V370E possibly damaging Het
Alms1 T C 6: 85,628,306 C1844R probably benign Het
Apaf1 T C 10: 90,995,680 K1191E probably benign Het
Bsn C T 9: 108,139,491 R107Q possibly damaging Het
Catsperb G T 12: 101,481,048 R269L probably damaging Het
Ccer1 T C 10: 97,693,942 S156P unknown Het
Cdh16 C T 8: 104,619,940 A241T probably benign Het
Cdk5rap2 A G 4: 70,254,735 S1367P probably damaging Het
Cds2 C T 2: 132,293,315 P42L probably benign Het
Col15a1 T C 4: 47,245,431 Y61H possibly damaging Het
Dclre1a G A 19: 56,542,650 P755S probably damaging Het
Ddi1 A T 9: 6,265,670 M233K probably damaging Het
Dpp4 T C 2: 62,356,989 Y474C probably damaging Het
Epha7 T A 4: 28,871,838 M389K probably benign Het
Ephb3 T C 16: 21,214,707 F181S probably damaging Het
Epor G A 9: 21,963,480 probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fbp2 C A 13: 62,837,253 V285L probably benign Het
Flnc A T 6: 29,452,259 D1694V probably damaging Het
Ganab T A 19: 8,904,975 M98K probably benign Het
Gcm2 A G 13: 41,105,754 S80P probably damaging Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm14124 A C 2: 150,266,161 T14P possibly damaging Het
Gm16286 T C 18: 80,211,659 V56A possibly damaging Het
Gne T C 4: 44,044,857 N426D probably benign Het
Ifne A T 4: 88,879,603 *193R probably null Het
Igf2r G T 17: 12,698,228 S1595* probably null Het
Krt26 C T 11: 99,335,061 M226I probably benign Het
Lars2 G A 9: 123,459,503 V805I probably benign Het
Lrrc57 C A 2: 120,606,096 R177L probably damaging Het
Lrrn1 A G 6: 107,569,122 E627G probably benign Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Mdga1 A T 17: 29,850,673 V133E probably damaging Het
Med12l A G 3: 59,091,550 T644A probably benign Het
Meis1 T A 11: 18,988,357 D218V probably damaging Het
Myo15b A G 11: 115,878,144 E1439G Het
Nckipsd G A 9: 108,814,081 V401I probably benign Het
Nrg3 T C 14: 38,370,712 I655V probably damaging Het
Olfr1290 A C 2: 111,489,588 I190R probably benign Het
Olfr470 T C 7: 107,845,514 D73G probably damaging Het
Olfr665 A T 7: 104,880,850 I48F probably benign Het
Oprm1 A T 10: 6,828,919 I107F probably damaging Het
Osbpl7 T C 11: 97,054,878 probably null Het
Pcdh18 T G 3: 49,744,783 S1077R possibly damaging Het
Pcdhb16 A T 18: 37,478,922 K312* probably null Het
Plekhh2 A T 17: 84,566,296 E336D probably benign Het
Ptprd A T 4: 76,246,839 S49T probably benign Het
Pxdn A G 12: 30,002,928 I1035V probably benign Het
Rlf C T 4: 121,150,100 G671D probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Selenbp2 A G 3: 94,700,097 Q275R probably benign Het
Slc10a1 G T 12: 80,960,622 F128L probably benign Het
Slitrk1 A T 14: 108,911,925 Y451* probably null Het
Stambpl1 G C 19: 34,226,716 G69R probably damaging Het
Surf4 G T 2: 26,924,443 R149S probably benign Het
Tmem151a T C 19: 5,082,674 Y168C probably damaging Het
Ttc39c A G 18: 12,728,689 K416R possibly damaging Het
Vit T C 17: 78,624,880 I472T probably damaging Het
Vmn1r212 A C 13: 22,883,548 L205R probably damaging Het
Wscd2 T C 5: 113,577,341 I414T probably benign Het
Zcchc11 T C 4: 108,549,336 I1367T possibly damaging Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31920951 missense possibly damaging 0.90
IGL01411:A1cf APN 19 31911229 missense possibly damaging 0.94
IGL01445:A1cf APN 19 31945798 missense probably benign 0.32
IGL02165:A1cf APN 19 31927186 missense possibly damaging 0.92
IGL02543:A1cf APN 19 31918095 missense probably damaging 0.97
IGL02651:A1cf APN 19 31932506 missense probably benign 0.25
IGL02904:A1cf APN 19 31934806 missense probably damaging 1.00
Haywire UTSW 19 31918124 critical splice donor site probably null
R0281:A1cf UTSW 19 31945814 missense probably benign 0.09
R0349:A1cf UTSW 19 31932662 missense possibly damaging 0.62
R0662:A1cf UTSW 19 31920938 missense probably benign 0.00
R0697:A1cf UTSW 19 31911167 missense probably damaging 1.00
R1055:A1cf UTSW 19 31932519 missense probably benign 0.05
R1125:A1cf UTSW 19 31920978 missense probably benign 0.00
R1448:A1cf UTSW 19 31908796 missense possibly damaging 0.88
R1554:A1cf UTSW 19 31908902 missense possibly damaging 0.66
R1616:A1cf UTSW 19 31934775 missense probably damaging 0.98
R1660:A1cf UTSW 19 31893107 nonsense probably null
R1719:A1cf UTSW 19 31927126 missense probably damaging 1.00
R2338:A1cf UTSW 19 31932545 missense probably benign
R2435:A1cf UTSW 19 31920894 missense probably benign 0.02
R2890:A1cf UTSW 19 31918017 missense probably benign 0.05
R3688:A1cf UTSW 19 31911169 missense probably damaging 1.00
R4007:A1cf UTSW 19 31918124 critical splice donor site probably null
R4208:A1cf UTSW 19 31932660 missense probably benign 0.00
R4448:A1cf UTSW 19 31945862 missense probably benign
R5072:A1cf UTSW 19 31917985 missense probably benign 0.18
R5491:A1cf UTSW 19 31918062 missense possibly damaging 0.57
R5636:A1cf UTSW 19 31944982 nonsense probably null
R5932:A1cf UTSW 19 31893118 missense possibly damaging 0.68
R7066:A1cf UTSW 19 31927114 missense probably damaging 0.99
R7211:A1cf UTSW 19 31927141 missense probably benign 0.23
R7545:A1cf UTSW 19 31934790 missense possibly damaging 0.80
R8020:A1cf UTSW 19 31893194 missense probably benign 0.01
R8344:A1cf UTSW 19 31911119 missense possibly damaging 0.77
R8497:A1cf UTSW 19 31945850 missense probably benign
Z1176:A1cf UTSW 19 31918017 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGTGCCAGTGTGGACAATTG -3'
(R):5'- GATCAAAGTTCTCCTGATGTGCAG -3'

Sequencing Primer
(F):5'- CCGATTGTTTGTGGGAGGAATCC -3'
(R):5'- GCAGAGGTGTGACTTTTCCAAAATAC -3'
Posted On2019-10-07