Incidental Mutation 'R7414:Ankrd44'
ID575256
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7414 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54667380 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 639 (H639L)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000178226] [ENSMUST00000179030]
Predicted Effect probably damaging
Transcript: ENSMUST00000044359
AA Change: H657L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: H657L

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178226
AA Change: H454L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331
AA Change: H454L

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179030
AA Change: H639L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: H639L

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Meta Mutation Damage Score 0.4692 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcy4 G A 14: 55,781,633 L156F probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bap1 G C 14: 31,253,615 G139R probably benign Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Fbn2 C T 18: 58,096,050 R696H probably damaging Het
Gbf1 C A 19: 46,283,358 Y159* probably null Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lgals12 T C 19: 7,603,970 K124R probably damaging Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrrc32 A T 7: 98,499,994 Q660H probably benign Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
Myo15 T A 11: 60,483,483 D121E Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Pxdc1 A G 13: 34,637,152 probably benign Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc16a10 G A 10: 40,141,996 T14M probably benign Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Snai1 C A 2: 167,538,668 probably null Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Thsd7b A T 1: 129,628,980 I435F probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vmn1r213 A G 13: 23,011,276 I10V unknown Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7490:Ankrd44 UTSW 1 54648300 missense probably benign 0.03
R7501:Ankrd44 UTSW 1 54649363 missense
R7515:Ankrd44 UTSW 1 54766355 missense probably damaging 1.00
R7527:Ankrd44 UTSW 1 54648324 missense probably benign 0.08
R7807:Ankrd44 UTSW 1 54792476 missense probably damaging 1.00
RF021:Ankrd44 UTSW 1 54778312 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGCGTCAAGGGTCAAAG -3'
(R):5'- ATGGGCATCACCAAGCCTTG -3'

Sequencing Primer
(F):5'- AACTGAATAAAGCAGTGTGCAGGTTG -3'
(R):5'- CAAGCCTTGGAGGTCCTTC -3'
Posted On2019-10-07