Incidental Mutation 'R7414:Thsd7b'
ID575259
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7414 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129628980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 435 (I435F)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040311] [ENSMUST00000073527] [ENSMUST00000152305]
Predicted Effect probably damaging
Transcript: ENSMUST00000040311
AA Change: I435F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041716
Gene: ENSMUSG00000042581
AA Change: I435F

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 3e-29 BLAST
Blast:TSP1 122 177 7e-24 BLAST
TSP1 182 233 2.47e-9 SMART
Blast:TSP1 290 338 1e-20 BLAST
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 1e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 4e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1051 1.15e-4 SMART
transmembrane domain 1070 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073527
AA Change: I435F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: I435F

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152305
AA Change: I358F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117750
Gene: ENSMUSG00000042581
AA Change: I358F

DomainStartEndE-ValueType
Blast:TSP1 45 100 8e-25 BLAST
TSP1 105 156 2.47e-9 SMART
Blast:TSP1 213 261 2e-21 BLAST
TSP1 262 322 7e-9 SMART
Blast:TSP1 325 379 1e-13 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcy4 G A 14: 55,781,633 L156F probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Ankrd44 T A 1: 54,667,380 H639L probably damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bap1 G C 14: 31,253,615 G139R probably benign Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Fbn2 C T 18: 58,096,050 R696H probably damaging Het
Gbf1 C A 19: 46,283,358 Y159* probably null Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lgals12 T C 19: 7,603,970 K124R probably damaging Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrrc32 A T 7: 98,499,994 Q660H probably benign Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
Myo15 T A 11: 60,483,483 D121E Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Pxdc1 A G 13: 34,637,152 probably benign Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc16a10 G A 10: 40,141,996 T14M probably benign Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Snai1 C A 2: 167,538,668 probably null Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vmn1r213 A G 13: 23,011,276 I10V unknown Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130103153 missense probably benign 0.01
R7334:Thsd7b UTSW 1 130195275 missense probably benign 0.00
R7683:Thsd7b UTSW 1 129595946 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTACACATTTGATGATATTGCCTG -3'
(R):5'- GCACGTTGAAGGAAGGTCTTAG -3'

Sequencing Primer
(F):5'- ACATTTGATGATATTGCCTGCTTTC -3'
(R):5'- AAGGTCTTAGTGGATGGATATGATAG -3'
Posted On2019-10-07