Incidental Mutation 'R0626:Baz1a'
ID57529
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0626 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54975270 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 76 (Q76K)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000172875] [ENSMUST00000173177] [ENSMUST00000173433] [ENSMUST00000173529]
Predicted Effect probably benign
Transcript: ENSMUST00000038926
AA Change: Q76K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: Q76K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172875
AA Change: Q76K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134384
Gene: ENSMUSG00000035021
AA Change: Q76K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173177
AA Change: Q76K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133796
Gene: ENSMUSG00000035021
AA Change: Q76K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 86 5.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: Q76K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: Q76K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173529
AA Change: Q76K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134445
Gene: ENSMUSG00000035021
AA Change: Q76K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 82 7.5e-26 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8009:Baz1a UTSW 12 54895031 nonsense probably null
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGCCATTGTTCCGAATGACTTCCAC -3'
(R):5'- AGAACCGGCATTGTAAGCATCTCTC -3'

Sequencing Primer
(F):5'- GAATGACTTCCACAGTCTCTTCAAC -3'
(R):5'- TTAAAGAGTAAGTTGATGAGGTGGC -3'
Posted On2013-07-11