Incidental Mutation 'R0626:Plekhh1'
ID57530
Institutional Source Beutler Lab
Gene Symbol Plekhh1
Ensembl Gene ENSMUSG00000060716
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0626 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location79029163-79081655 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 79040585 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 16 (R16*)
Ref Sequence ENSEMBL: ENSMUSP00000151747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039928] [ENSMUST00000217954] [ENSMUST00000219956]
Predicted Effect probably null
Transcript: ENSMUST00000039928
AA Change: R16*
SMART Domains Protein: ENSMUSP00000049460
Gene: ENSMUSG00000060716
AA Change: R16*

DomainStartEndE-ValueType
coiled coil region 26 172 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
PH 573 668 1.15e-22 SMART
PH 682 792 3.23e-8 SMART
MyTH4 826 980 3e-48 SMART
B41 987 1224 6.07e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217954
AA Change: R16*
Predicted Effect probably null
Transcript: ENSMUST00000219956
AA Change: R16*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Plekhh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Plekhh1 APN 12 79078964 missense probably benign 0.35
IGL01764:Plekhh1 APN 12 79054905 missense probably benign 0.00
IGL01922:Plekhh1 APN 12 79079579 missense probably benign
IGL02187:Plekhh1 APN 12 79072818 missense probably damaging 1.00
IGL02406:Plekhh1 APN 12 79069009 splice site probably benign
IGL02581:Plekhh1 APN 12 79079108 critical splice donor site probably null
IGL03201:Plekhh1 APN 12 79053656 missense probably damaging 1.00
R0088:Plekhh1 UTSW 12 79055366 missense probably benign 0.00
R0662:Plekhh1 UTSW 12 79078993 missense probably benign 0.09
R0666:Plekhh1 UTSW 12 79069115 missense probably damaging 0.99
R0966:Plekhh1 UTSW 12 79065730 missense probably damaging 1.00
R1027:Plekhh1 UTSW 12 79054482 splice site probably benign
R1507:Plekhh1 UTSW 12 79079450 missense probably damaging 1.00
R1562:Plekhh1 UTSW 12 79076708 missense probably benign 0.00
R1759:Plekhh1 UTSW 12 79072761 missense probably damaging 1.00
R1839:Plekhh1 UTSW 12 79078957 splice site probably benign
R2125:Plekhh1 UTSW 12 79079000 missense probably damaging 1.00
R2345:Plekhh1 UTSW 12 79053647 missense probably damaging 1.00
R3895:Plekhh1 UTSW 12 79055232 missense probably benign
R3927:Plekhh1 UTSW 12 79053648 missense probably damaging 1.00
R4039:Plekhh1 UTSW 12 79055183 missense probably benign 0.01
R4720:Plekhh1 UTSW 12 79075420 frame shift probably null
R4721:Plekhh1 UTSW 12 79075420 frame shift probably null
R4824:Plekhh1 UTSW 12 79054803 missense probably benign
R4869:Plekhh1 UTSW 12 79050386 missense probably benign
R5114:Plekhh1 UTSW 12 79069106 missense probably benign 0.00
R5809:Plekhh1 UTSW 12 79078687 missense probably benign 0.26
R6540:Plekhh1 UTSW 12 79064489 missense probably benign 0.14
R6977:Plekhh1 UTSW 12 79065717 missense probably damaging 1.00
R7058:Plekhh1 UTSW 12 79075430 missense probably damaging 1.00
R7103:Plekhh1 UTSW 12 79066655 missense probably benign 0.01
R7120:Plekhh1 UTSW 12 79070939 missense probably benign 0.03
R7134:Plekhh1 UTSW 12 79062616 missense probably benign 0.00
R7209:Plekhh1 UTSW 12 79050376 missense probably benign 0.04
R7403:Plekhh1 UTSW 12 79040577 nonsense probably null
R7405:Plekhh1 UTSW 12 79055047 missense probably benign 0.00
R7449:Plekhh1 UTSW 12 79079552 missense probably benign 0.00
R7594:Plekhh1 UTSW 12 79076503 missense possibly damaging 0.89
R7648:Plekhh1 UTSW 12 79055131 missense probably benign 0.20
R7756:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R7758:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R8033:Plekhh1 UTSW 12 79070936 missense probably benign 0.23
R8129:Plekhh1 UTSW 12 79073438 missense probably damaging 0.99
R8153:Plekhh1 UTSW 12 79079038 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGTCCAGATGCTGCTCAGCCAC -3'
(R):5'- TGTATCATTTGTCCATGCCTGGCAC -3'

Sequencing Primer
(F):5'- AGTTGGAACCACCCTCGTC -3'
(R):5'- gggagagagggaaagaggg -3'
Posted On2013-07-11