Incidental Mutation 'R7414:Lrrc32'
ID575302
Institutional Source Beutler Lab
Gene Symbol Lrrc32
Ensembl Gene ENSMUSG00000090958
Gene Nameleucine rich repeat containing 32
SynonymsD7H11S833E, EG434215, Garp, D11S833Eh
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R7414 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98489283-98502181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98499994 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 660 (Q660H)
Ref Sequence ENSEMBL: ENSMUSP00000133205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165205] [ENSMUST00000205937] [ENSMUST00000205956]
Predicted Effect probably benign
Transcript: ENSMUST00000165205
AA Change: Q660H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133205
Gene: ENSMUSG00000090958
AA Change: Q660H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:LRRNT 22 54 3e-12 BLAST
LRR_TYP 73 96 9.44e-2 SMART
LRR 97 123 1.86e2 SMART
LRR 124 148 3.01e2 SMART
LRR 149 172 5.41e0 SMART
LRR 173 196 1.51e0 SMART
LRR_TYP 197 220 7.67e-2 SMART
LRR 265 287 1.49e2 SMART
LRR 315 338 4.97e0 SMART
LRR 339 362 8.01e0 SMART
LRR 363 384 5.57e1 SMART
LRR_TYP 386 409 3.44e-4 SMART
low complexity region 425 437 N/A INTRINSIC
LRR 443 466 2.33e2 SMART
LRR 514 536 2.03e1 SMART
LRR 537 559 2.61e1 SMART
Blast:LRR 561 588 6e-11 BLAST
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205937
Predicted Effect probably benign
Transcript: ENSMUST00000205956
AA Change: Q660H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein which contains 20 leucine-rich repeats. Alterations in the chromosomal region 11q13-11q14 are involved in several pathologies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit reduced regulatory T cell ability to drive Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcy4 G A 14: 55,781,633 L156F probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Ankrd44 T A 1: 54,667,380 H639L probably damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bap1 G C 14: 31,253,615 G139R probably benign Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Fbn2 C T 18: 58,096,050 R696H probably damaging Het
Gbf1 C A 19: 46,283,358 Y159* probably null Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lgals12 T C 19: 7,603,970 K124R probably damaging Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
Myo15 T A 11: 60,483,483 D121E Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Pxdc1 A G 13: 34,637,152 probably benign Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc16a10 G A 10: 40,141,996 T14M probably benign Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Snai1 C A 2: 167,538,668 probably null Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Thsd7b A T 1: 129,628,980 I435F probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vmn1r213 A G 13: 23,011,276 I10V unknown Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Lrrc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Lrrc32 APN 7 98498376 missense probably damaging 1.00
IGL01484:Lrrc32 APN 7 98494235 missense probably damaging 0.99
IGL01608:Lrrc32 APN 7 98499357 missense probably benign 0.01
IGL02025:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL02026:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL03061:Lrrc32 APN 7 98499422 missense probably benign 0.04
IGL03191:Lrrc32 APN 7 98498247 missense possibly damaging 0.66
R0706:Lrrc32 UTSW 7 98499710 missense probably damaging 1.00
R0947:Lrrc32 UTSW 7 98498883 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R2879:Lrrc32 UTSW 7 98499777 missense probably benign 0.02
R3608:Lrrc32 UTSW 7 98499186 missense probably benign 0.09
R4417:Lrrc32 UTSW 7 98498937 missense probably benign 0.01
R4798:Lrrc32 UTSW 7 98499017 missense probably damaging 1.00
R4872:Lrrc32 UTSW 7 98498520 missense probably damaging 0.99
R5813:Lrrc32 UTSW 7 98498411 missense probably damaging 1.00
R6062:Lrrc32 UTSW 7 98498541 missense probably benign 0.00
R6742:Lrrc32 UTSW 7 98498832 missense probably benign 0.00
R6930:Lrrc32 UTSW 7 98499264 missense possibly damaging 0.89
R7265:Lrrc32 UTSW 7 98499437 missense probably damaging 1.00
R7367:Lrrc32 UTSW 7 98498879 nonsense probably null
R7372:Lrrc32 UTSW 7 98499807 missense probably benign 0.28
R7485:Lrrc32 UTSW 7 98498207 missense possibly damaging 0.94
R7679:Lrrc32 UTSW 7 98499687 missense possibly damaging 0.91
R7713:Lrrc32 UTSW 7 98499338 missense probably damaging 0.99
Z1088:Lrrc32 UTSW 7 98499060 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGACCTAATCTGCCGCTTTG -3'
(R):5'- AACAGATACTCAGCGTCGAG -3'

Sequencing Primer
(F):5'- GCTTTGGCTCCCAGGAG -3'
(R):5'- GGCATCCTCTGTGCAGTAAACTG -3'
Posted On2019-10-07