Incidental Mutation 'R7414:Myo15'
ID575322
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Namemyosin XV
Synonymssh2; sh-2; Myo15a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7414 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location60469339-60528369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60483483 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 121 (D121E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably damaging
Transcript: ENSMUST00000071880
AA Change: D1288E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: D1288E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081823
AA Change: D101E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: D101E

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094135
AA Change: D1288E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: D1288E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: D121E

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcy4 G A 14: 55,781,633 L156F probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Ankrd44 T A 1: 54,667,380 H639L probably damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Fbn2 C T 18: 58,096,050 R696H probably damaging Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lgals12 T C 19: 7,603,970 K124R probably damaging Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrrc32 A T 7: 98,499,994 Q660H probably benign Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Thsd7b A T 1: 129,628,980 I435F probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
Typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 unclassified probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
R7041:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R7149:Myo15 UTSW 11 60510010 missense possibly damaging 0.56
R7163:Myo15 UTSW 11 60498369 missense
R7229:Myo15 UTSW 11 60496495 missense probably benign 0.08
R7347:Myo15 UTSW 11 60477961 missense probably benign
R7368:Myo15 UTSW 11 60490915 intron probably null
R7392:Myo15 UTSW 11 60505976 missense
R7461:Myo15 UTSW 11 60505152 missense
R7609:Myo15 UTSW 11 60488811 missense
R7613:Myo15 UTSW 11 60505152 missense
R7734:Myo15 UTSW 11 60510282 missense probably benign
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACTGTAGCTCTGACTGAGGG -3'
(R):5'- CAGTCTTTCCAGAGCCACTC -3'

Sequencing Primer
(F):5'- AGCTCTGACTGAGGGTGAGG -3'
(R):5'- CACTGGTGGAACAGGAGCC -3'
Posted On2019-10-07