Incidental Mutation 'R7414:Adcy4'
ID575329
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Nameadenylate cyclase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7414 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55769057-55784095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55781633 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 156 (L156F)
Ref Sequence ENSEMBL: ENSMUSP00000002398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228476]
Predicted Effect probably benign
Transcript: ENSMUST00000002398
AA Change: L156F

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: L156F

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022830
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168716
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170223
AA Change: L156F

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: L156F

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178399
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Ankrd44 T A 1: 54,667,380 H639L probably damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bap1 G C 14: 31,253,615 G139R probably benign Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Fbn2 C T 18: 58,096,050 R696H probably damaging Het
Gbf1 C A 19: 46,283,358 Y159* probably null Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lgals12 T C 19: 7,603,970 K124R probably damaging Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrrc32 A T 7: 98,499,994 Q660H probably benign Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
Myo15 T A 11: 60,483,483 D121E Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Pxdc1 A G 13: 34,637,152 probably benign Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc16a10 G A 10: 40,141,996 T14M probably benign Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Snai1 C A 2: 167,538,668 probably null Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Thsd7b A T 1: 129,628,980 I435F probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vmn1r213 A G 13: 23,011,276 I10V unknown Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 55773663 splice site probably null
IGL02406:Adcy4 APN 14 55770047 missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 55771505 missense probably damaging 1.00
IGL02543:Adcy4 APN 14 55769170 missense probably benign
IGL02616:Adcy4 APN 14 55783514 unclassified probably null
IGL03002:Adcy4 APN 14 55773556 missense probably benign 0.31
IGL03026:Adcy4 APN 14 55778010 missense probably damaging 1.00
IGL03190:Adcy4 APN 14 55779053 missense probably damaging 1.00
IGL03247:Adcy4 APN 14 55770096 missense probably damaging 1.00
stressed UTSW 14 55779099 intron probably null
IGL03098:Adcy4 UTSW 14 55781581 missense probably null 0.82
R0098:Adcy4 UTSW 14 55769827 missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 55771533 missense probably benign 0.29
R0396:Adcy4 UTSW 14 55772288 missense probably benign 0.00
R0482:Adcy4 UTSW 14 55774572 critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 55781597 missense probably benign
R0691:Adcy4 UTSW 14 55772647 splice site probably benign
R0704:Adcy4 UTSW 14 55772756 missense probably benign
R0815:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R0863:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R1446:Adcy4 UTSW 14 55770023 critical splice donor site probably null
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 55778939 missense probably damaging 1.00
R1624:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 55771472 missense probably benign 0.01
R1878:Adcy4 UTSW 14 55769905 missense probably damaging 0.96
R2007:Adcy4 UTSW 14 55778313 missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 55769170 missense probably benign 0.09
R2425:Adcy4 UTSW 14 55778017 missense probably damaging 0.99
R2517:Adcy4 UTSW 14 55781946 missense probably damaging 1.00
R3882:Adcy4 UTSW 14 55774546 missense probably benign 0.27
R4021:Adcy4 UTSW 14 55775178 intron probably null
R4022:Adcy4 UTSW 14 55775178 intron probably null
R4411:Adcy4 UTSW 14 55769443 missense probably damaging 1.00
R4530:Adcy4 UTSW 14 55779028 missense probably damaging 1.00
R4560:Adcy4 UTSW 14 55778950 unclassified probably null
R4704:Adcy4 UTSW 14 55775025 missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 55775036 missense probably benign 0.07
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 55773722 missense probably benign
R4890:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4920:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4948:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4952:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4953:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4987:Adcy4 UTSW 14 55773477 missense probably benign 0.01
R4991:Adcy4 UTSW 14 55773465 missense probably benign 0.03
R5080:Adcy4 UTSW 14 55772375 missense probably damaging 0.98
R5620:Adcy4 UTSW 14 55772367 nonsense probably null
R5652:Adcy4 UTSW 14 55773443 missense probably benign
R5726:Adcy4 UTSW 14 55783661 missense probably damaging 1.00
R5910:Adcy4 UTSW 14 55779013 missense probably damaging 1.00
R5958:Adcy4 UTSW 14 55779099 intron probably null
R6280:Adcy4 UTSW 14 55779043 missense probably damaging 1.00
R6318:Adcy4 UTSW 14 55769224 missense probably damaging 1.00
R6598:Adcy4 UTSW 14 55770045 missense probably benign 0.03
R6947:Adcy4 UTSW 14 55778391 missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 55779919 missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 55779725 missense probably damaging 1.00
R7386:Adcy4 UTSW 14 55778327 missense probably damaging 1.00
R7431:Adcy4 UTSW 14 55772672 missense probably benign 0.01
R7490:Adcy4 UTSW 14 55770433 missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 55773465 missense probably benign 0.00
R7672:Adcy4 UTSW 14 55780905 missense probably benign 0.14
X0025:Adcy4 UTSW 14 55770391 missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 55780956 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCCTCTTCTGACAAAGGTAG -3'
(R):5'- CAAATTTAGACCCTGGGCGC -3'

Sequencing Primer
(F):5'- CCTCTTCTGACAAAGGTAGGCATG -3'
(R):5'- TTAGACCCTGGGCGCAACATC -3'
Posted On2019-10-07