Incidental Mutation 'R7414:Fbn2'
ID 575345
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Name fibrillin 2
Synonyms Fib-2, sy, Sne
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock # R7414 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 58008623-58209926 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58096050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 696 (R696H)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000025497
AA Change: R696H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: R696H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Meta Mutation Damage Score 0.2863 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcy4 G A 14: 55,781,633 L156F probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Ankrd44 T A 1: 54,667,380 H639L probably damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bap1 G C 14: 31,253,615 G139R probably benign Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Gbf1 C A 19: 46,283,358 Y159* probably null Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lgals12 T C 19: 7,603,970 K124R probably damaging Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrrc32 A T 7: 98,499,994 Q660H probably benign Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
Myo15 T A 11: 60,483,483 D121E Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Pxdc1 A G 13: 34,637,152 probably benign Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc16a10 G A 10: 40,141,996 T14M probably benign Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Snai1 C A 2: 167,538,668 probably null Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Thsd7b A T 1: 129,628,980 I435F probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vmn1r213 A G 13: 23,011,276 I10V unknown Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
BB009:Fbn2 UTSW 18 58020483 missense possibly damaging 0.61
BB019:Fbn2 UTSW 18 58020483 missense possibly damaging 0.61
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 splice site probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
R7199:Fbn2 UTSW 18 58053761 nonsense probably null
R7219:Fbn2 UTSW 18 58053027 missense probably benign 0.04
R7226:Fbn2 UTSW 18 58037070 missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58066116 missense probably benign 0.14
R7485:Fbn2 UTSW 18 58071840 missense possibly damaging 0.50
R7523:Fbn2 UTSW 18 58066080 missense probably benign 0.01
R7549:Fbn2 UTSW 18 58020464 nonsense probably null
R7619:Fbn2 UTSW 18 58080227 missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58105136 missense probably damaging 1.00
R7789:Fbn2 UTSW 18 58039313 missense probably benign 0.22
R7932:Fbn2 UTSW 18 58020483 missense possibly damaging 0.61
R8013:Fbn2 UTSW 18 58104081 missense possibly damaging 0.62
R8076:Fbn2 UTSW 18 58026424 nonsense probably null
R8300:Fbn2 UTSW 18 58209615 missense probably benign
R8345:Fbn2 UTSW 18 58058431 missense probably damaging 1.00
R8487:Fbn2 UTSW 18 58020390 missense possibly damaging 0.53
R8520:Fbn2 UTSW 18 58038198 critical splice donor site probably null
R8781:Fbn2 UTSW 18 58061647 missense possibly damaging 0.88
R8801:Fbn2 UTSW 18 58153949 missense probably damaging 1.00
R8857:Fbn2 UTSW 18 58153861 missense probably damaging 1.00
R8878:Fbn2 UTSW 18 58124246 missense probably benign 0.30
R8909:Fbn2 UTSW 18 58059436 missense possibly damaging 0.88
R8973:Fbn2 UTSW 18 58153856 missense probably damaging 1.00
R8975:Fbn2 UTSW 18 58153856 missense probably damaging 1.00
R8979:Fbn2 UTSW 18 58153856 missense probably damaging 1.00
R8991:Fbn2 UTSW 18 58106323 missense probably damaging 1.00
R9003:Fbn2 UTSW 18 58043519 missense probably damaging 1.00
R9205:Fbn2 UTSW 18 58059356 missense probably damaging 1.00
R9215:Fbn2 UTSW 18 58076675 missense probably damaging 1.00
R9263:Fbn2 UTSW 18 58124272 missense probably damaging 1.00
R9307:Fbn2 UTSW 18 58209784 missense probably benign
R9337:Fbn2 UTSW 18 58209651 missense probably benign
R9403:Fbn2 UTSW 18 58066107 missense probably damaging 1.00
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Z1177:Fbn2 UTSW 18 58010379 missense probably benign 0.00
Z1177:Fbn2 UTSW 18 58055482 missense probably benign 0.00
Z1177:Fbn2 UTSW 18 58069190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAATCCTACTGTTGAGTTTCTAG -3'
(R):5'- ACTTCAGATGGGTAGGGCTG -3'

Sequencing Primer
(F):5'- AGTTTCTTACGATGTGCAGTTACC -3'
(R):5'- GGGACCATAGTCGTTGGTAC -3'
Posted On 2019-10-07