Incidental Mutation 'R7414:Lgals12'
ID575347
Institutional Source Beutler Lab
Gene Symbol Lgals12
Ensembl Gene ENSMUSG00000024972
Gene Namelectin, galactose binding, soluble 12
SynonymsGRIP1, galectin-12, galectin-related inhibitor of proliferation
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7414 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7596660-7607193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7603970 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 124 (K124R)
Ref Sequence ENSEMBL: ENSMUSP00000097318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079902] [ENSMUST00000099729] [ENSMUST00000159983]
Predicted Effect probably damaging
Transcript: ENSMUST00000079902
AA Change: K124R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078824
Gene: ENSMUSG00000024972
AA Change: K124R

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 181 301 3.6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099729
AA Change: K124R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097318
Gene: ENSMUSG00000024972
AA Change: K124R

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159983
AA Change: K124R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124610
Gene: ENSMUSG00000024972
AA Change: K124R

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lipolysis, reduced adiposity, and enhanced insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,024 T90M probably damaging Het
4922502D21Rik T C 6: 129,325,633 T144A probably benign Het
Abca4 T A 3: 122,102,738 S540T probably benign Het
Adcy4 G A 14: 55,781,633 L156F probably benign Het
Adcyap1 T A 17: 93,202,828 L95M probably damaging Het
Ahctf1 T C 1: 179,784,105 T567A probably benign Het
Ankrd26 T C 6: 118,508,780 I1378V possibly damaging Het
Ankrd44 T A 1: 54,667,380 H639L probably damaging Het
Arfrp1 C T 2: 181,359,514 R189Q possibly damaging Het
Astn2 T C 4: 65,540,956 D1126G possibly damaging Het
Bap1 G C 14: 31,253,615 G139R probably benign Het
Bms1 C T 6: 118,383,745 R1254Q possibly damaging Het
C330027C09Rik T C 16: 49,001,635 F209L probably benign Het
Ceacam15 A G 7: 16,673,310 V94A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clock T C 5: 76,262,764 T87A probably benign Het
Cntrl A T 2: 35,165,467 I1706L probably benign Het
Cr2 C A 1: 195,150,036 V981L probably benign Het
Cxcr6 G A 9: 123,810,222 W103* probably null Het
Dld A T 12: 31,335,526 F272Y probably damaging Het
Dmrt2 T A 19: 25,673,586 D45E probably benign Het
Eif2a T A 3: 58,526,081 L8* probably null Het
Epg5 G T 18: 77,983,532 R1246L possibly damaging Het
Ets1 T A 9: 32,752,857 C350* probably null Het
Fam135b C T 15: 71,478,256 R345Q probably damaging Het
Fam196a G T 7: 134,918,009 A264D probably benign Het
Fbn2 C T 18: 58,096,050 R696H probably damaging Het
Gbf1 C A 19: 46,283,358 Y159* probably null Het
Gcsam T C 16: 45,616,938 probably null Het
Gmpr2 G T 14: 55,672,802 probably null Het
H2-T3 C A 17: 36,187,383 V257L not run Het
Hadha A G 5: 30,126,612 F449L possibly damaging Het
Haus3 T A 5: 34,166,133 I378L probably benign Het
Hdac7 T A 15: 97,808,511 H272L probably benign Het
Icam5 T C 9: 21,037,593 V747A probably damaging Het
Ifrd2 G A 9: 107,590,171 V81M possibly damaging Het
Ipcef1 G T 10: 6,890,673 C345* probably null Het
Ipmk T A 10: 71,381,294 F223I probably damaging Het
Itpr2 A T 6: 146,373,208 N825K probably benign Het
Kazn G A 4: 142,109,338 T530I Het
Kmt2d C T 15: 98,839,856 V5120M unknown Het
Krt6b T G 15: 101,679,014 D215A probably benign Het
Lpar6 T A 14: 73,238,800 V67D probably damaging Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrrc32 A T 7: 98,499,994 Q660H probably benign Het
Lurap1l T A 4: 80,953,754 H161Q probably benign Het
Map3k19 A G 1: 127,838,452 I245T probably damaging Het
Mcf2l T A 8: 13,019,022 *1119K probably null Het
Mertk C A 2: 128,729,393 A89E possibly damaging Het
Mical3 A T 6: 121,034,113 Y375N probably damaging Het
Myo15 T A 11: 60,483,483 D121E Het
N4bp2l1 T A 5: 150,576,293 N116I probably damaging Het
Nbeal1 T C 1: 60,194,597 probably null Het
Nlrp12 A T 7: 3,241,347 D178E probably benign Het
Nt5c2 C A 19: 46,889,889 G444C probably damaging Het
Olfr38 T A 6: 42,762,828 Y259N probably damaging Het
Olfr912 T C 9: 38,581,468 F64L probably benign Het
Olfr978 T A 9: 39,994,053 M81K possibly damaging Het
Pdcl2 A C 5: 76,312,512 S220A possibly damaging Het
Pip5kl1 T C 2: 32,578,235 S138P possibly damaging Het
Pkd1l1 A T 11: 8,916,267 N979K Het
Prkcb A T 7: 122,568,227 T387S possibly damaging Het
Pxdc1 A G 13: 34,637,152 probably benign Het
Sbf2 C T 7: 110,314,064 E1668K possibly damaging Het
Sec16a T G 2: 26,423,631 T455P Het
Sec24b C A 3: 130,009,865 V412F probably benign Het
Serpina3b A G 12: 104,132,886 N220S probably benign Het
Sgip1 C T 4: 102,967,624 Q581* probably null Het
Shf A T 2: 122,359,582 I175N possibly damaging Het
Slc16a10 G A 10: 40,141,996 T14M probably benign Het
Slc22a4 A T 11: 53,997,428 M258K probably benign Het
Slfn8 A T 11: 83,016,792 Y308* probably null Het
Slfnl1 T C 4: 120,535,254 Y249H probably damaging Het
Smchd1 T C 17: 71,475,079 Y29C probably damaging Het
Snai1 C A 2: 167,538,668 probably null Het
Sntg1 T C 1: 8,448,065 Y368C probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spop G A 11: 95,474,508 V126M probably damaging Het
Ssfa2 A G 2: 79,644,728 K344E possibly damaging Het
Taar3 A T 10: 23,949,817 Y87F probably damaging Het
Tarm1 C A 7: 3,496,802 M177I probably benign Het
Tcerg1l A G 7: 138,218,057 F485L probably damaging Het
Thsd7b A T 1: 129,628,980 I435F probably damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tigd4 T C 3: 84,593,821 V15A probably benign Het
Tll2 T C 19: 41,103,829 D523G probably damaging Het
Tmem117 A G 15: 94,714,895 D104G probably damaging Het
Tmem132b T C 5: 125,787,491 L887P probably damaging Het
Tnfrsf26 A T 7: 143,614,905 V132D probably damaging Het
Tomt T A 7: 101,900,508 D191V probably damaging Het
Ttc39b T C 4: 83,242,222 M373V probably damaging Het
Ttn G A 2: 76,738,149 P27467S possibly damaging Het
Ttn A C 2: 76,742,786 V25921G probably damaging Het
Ubxn2a A C 12: 4,891,381 V75G probably damaging Het
Uchl5 A T 1: 143,806,695 K319N unknown Het
Ugt2b1 T C 5: 86,925,834 D222G probably damaging Het
Vmn1r213 A G 13: 23,011,276 I10V unknown Het
Vps13b T C 15: 35,910,827 I3579T probably damaging Het
Xpo5 T A 17: 46,221,369 H443Q probably benign Het
Zfp316 A G 5: 143,264,652 M2T unknown Het
Zscan4-ps2 A G 7: 11,517,432 T160A possibly damaging Het
Other mutations in Lgals12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Lgals12 APN 19 7606654 splice site probably benign
IGL02630:Lgals12 APN 19 7601242 splice site probably benign
IGL02700:Lgals12 APN 19 7598090 missense probably benign 0.01
R0129:Lgals12 UTSW 19 7603038 missense probably damaging 0.99
R1398:Lgals12 UTSW 19 7603957 splice site probably benign
R1421:Lgals12 UTSW 19 7606714 missense probably benign 0.08
R1548:Lgals12 UTSW 19 7604312 missense probably benign 0.12
R1697:Lgals12 UTSW 19 7604165 missense possibly damaging 0.91
R2075:Lgals12 UTSW 19 7598845 missense possibly damaging 0.81
R2192:Lgals12 UTSW 19 7601241 splice site probably null
R2253:Lgals12 UTSW 19 7606765 start gained probably benign
R4256:Lgals12 UTSW 19 7606716 missense possibly damaging 0.93
R4738:Lgals12 UTSW 19 7604099 missense probably benign 0.01
R5495:Lgals12 UTSW 19 7604130 missense probably damaging 1.00
R5810:Lgals12 UTSW 19 7606720 missense probably benign 0.00
R6139:Lgals12 UTSW 19 7604377 missense probably benign 0.07
X0067:Lgals12 UTSW 19 7603964 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAGCATGGGTCTTCTGAGTG -3'
(R):5'- ATCCTCAGCCAGATGTTGCC -3'

Sequencing Primer
(F):5'- GAGTGTTTGCTCTGACCACGC -3'
(R):5'- AGCCAGATGTTGCCTTCCG -3'
Posted On2019-10-07