Incidental Mutation 'R7417:Zer1'
ID575356
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7417 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30102822 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 600 (L600P)
Ref Sequence ENSEMBL: ENSMUSP00000046441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect probably damaging
Transcript: ENSMUST00000044751
AA Change: L600P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: L600P

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113677
AA Change: L587P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: L587P

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Capn7 T C 14: 31,370,706 Y737H probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Cyp2j7 C T 4: 96,201,988 probably null Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Map3k6 T A 4: 133,248,396 S732T probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ripor2 A G 13: 24,696,550 D411G probably damaging Het
Sdr42e1 T C 8: 117,662,751 T384A probably benign Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Top3b G A 16: 16,877,850 probably benign Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
R7719:Zer1 UTSW 2 30111231 missense probably damaging 1.00
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTATCAAGAACAGAAACTGG -3'
(R):5'- GTGGAGCCACAATCCTCCCA -3'

Sequencing Primer
(F):5'- CTGGACAGAGCACAGTGTTCAC -3'
(R):5'- AAGTCAGCTCTCTTCGGGG -3'
Posted On2019-10-07