Incidental Mutation 'R7417:Cyp2j7'
ID575367
Institutional Source Beutler Lab
Gene Symbol Cyp2j7
Ensembl Gene ENSMUSG00000081362
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 7
SynonymsCyp2j7-ps, OTTMUSG00000007941
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7417 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location96195197-96236659 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 96201988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162514]
Predicted Effect probably null
Transcript: ENSMUST00000162514
SMART Domains Protein: ENSMUSP00000134331
Gene: ENSMUSG00000081362

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 499 3.7e-130 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Akr1b7 G A 6: 34,417,365 probably null Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Best2 C T 8: 85,009,666 probably null Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Capn7 T C 14: 31,370,706 Y737H probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Map3k6 T A 4: 133,248,396 S732T probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pde4d T A 13: 109,632,788 probably null Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ripor2 A G 13: 24,696,550 D411G probably damaging Het
Ryr2 A C 13: 11,556,748 probably null Het
Sdr42e1 T C 8: 117,662,751 T384A probably benign Het
Sec1 A T 7: 45,684,725 probably null Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Top3b G A 16: 16,877,850 probably benign Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Twnk G A 19: 45,010,564 probably null Het
Ube4a A C 9: 44,956,713 I45S probably benign Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Wdr63 A T 3: 146,093,080 probably null Het
Zer1 A G 2: 30,102,822 L600P probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Zrsr1 T C 11: 22,974,662 probably null Het
Other mutations in Cyp2j7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cyp2j7 APN 4 96227512 splice site probably benign
IGL00426:Cyp2j7 APN 4 96227513 splice site probably null
IGL01505:Cyp2j7 APN 4 96227680 critical splice acceptor site probably null
IGL02100:Cyp2j7 APN 4 96236556 missense probably damaging 0.99
IGL02183:Cyp2j7 APN 4 96230147 splice site probably benign
IGL02596:Cyp2j7 APN 4 96215422 missense possibly damaging 0.56
IGL02661:Cyp2j7 APN 4 96236650 missense probably benign
IGL02723:Cyp2j7 APN 4 96230129 missense probably benign 0.33
IGL03053:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03159:Cyp2j7 APN 4 96227512 splice site probably benign
IGL03168:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03174:Cyp2j7 APN 4 96195370 nonsense probably null
PIT4449001:Cyp2j7 UTSW 4 96215338 missense probably damaging 0.96
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0392:Cyp2j7 UTSW 4 96199434 missense probably damaging 1.00
R1447:Cyp2j7 UTSW 4 96195293 missense possibly damaging 0.90
R1778:Cyp2j7 UTSW 4 96199390 missense probably damaging 1.00
R1876:Cyp2j7 UTSW 4 96217419 missense probably benign 0.01
R4105:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4106:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4107:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4108:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4438:Cyp2j7 UTSW 4 96217409 missense probably benign 0.01
R4660:Cyp2j7 UTSW 4 96195342 missense probably benign 0.29
R6193:Cyp2j7 UTSW 4 96195203 missense probably damaging 1.00
R6380:Cyp2j7 UTSW 4 96229974 critical splice donor site probably null
R6427:Cyp2j7 UTSW 4 96227667 missense probably damaging 0.96
R6624:Cyp2j7 UTSW 4 96227618 missense probably damaging 0.99
R7196:Cyp2j7 UTSW 4 96215414 missense probably benign 0.03
R7780:Cyp2j7 UTSW 4 96230019 missense probably benign 0.00
R8062:Cyp2j7 UTSW 4 96215350 missense probably null 1.00
R8097:Cyp2j7 UTSW 4 96215410 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCACCTGTGACTTCAGATATGG -3'
(R):5'- AAGCTGGGTCCCCTGTTTTC -3'

Sequencing Primer
(F):5'- CTCTTATGAGTGAACATTAGCACAGG -3'
(R):5'- CCCTGTTTTCTTGCAGAAAGAG -3'
Posted On2019-10-07