Incidental Mutation 'R7417:Map3k6'
ID575373
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Namemitogen-activated protein kinase kinase kinase 6
SynonymsAsk2, MAPKKK6, MEKK6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R7417 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location133240818-133252929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133248396 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 732 (S732T)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030677
AA Change: S732T

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: S732T

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik G A 17: 48,152,889 T213I probably damaging Het
Aldh6a1 T C 12: 84,441,782 Q110R probably benign Het
Alg11 A T 8: 22,062,028 T63S probably benign Het
Ankrd13b A G 11: 77,476,194 Y271H probably damaging Het
Ano8 T A 8: 71,480,833 D605V unknown Het
Brca1 A G 11: 101,524,981 S776P probably damaging Het
Capn7 T C 14: 31,370,706 Y737H probably damaging Het
Cblc A T 7: 19,788,974 S333T probably benign Het
Ccm2 T A 11: 6,593,091 M257K probably benign Het
Cd320 T A 17: 33,847,556 C103* probably null Het
Cd53 A G 3: 106,768,919 F44S probably benign Het
Col9a2 G A 4: 121,054,292 R610H not run Het
Cubn T C 2: 13,426,967 I1272V probably benign Het
Cyp2j7 C T 4: 96,201,988 probably null Het
Dmrt2 A T 19: 25,678,598 R520S probably benign Het
Drg2 A G 11: 60,454,680 M1V probably null Het
Ect2 A G 3: 27,098,419 S908P probably damaging Het
Eipr1 A G 12: 28,866,955 T341A probably benign Het
Ell3 A C 2: 121,440,410 I214R probably benign Het
Emsy A T 7: 98,615,486 L568Q probably damaging Het
Foxd4 T C 19: 24,900,462 T125A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gcsam C A 16: 45,619,877 H94Q probably damaging Het
Ginm1 T A 10: 7,774,080 I150F probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hk2 G A 6: 82,743,345 A205V probably damaging Het
Il3ra A T 14: 14,349,345 H147L probably benign Het
Masp2 A G 4: 148,605,721 E229G probably benign Het
Mccc2 A G 13: 99,971,777 probably null Het
Mia3 A G 1: 183,327,653 V359A Het
Mob1a A T 6: 83,332,510 T80S probably benign Het
Msantd2 G A 9: 37,523,294 G478S probably damaging Het
Mtf1 A G 4: 124,825,181 E329G probably null Het
Myh9 T A 15: 77,763,865 K1804* probably null Het
Ndst3 A G 3: 123,671,664 W220R probably damaging Het
Nln A G 13: 104,036,970 L576P probably damaging Het
Nlrc4 A G 17: 74,446,488 M300T probably benign Het
Obscn G T 11: 59,129,577 D880E possibly damaging Het
Olfr1313 A C 2: 112,072,100 V161G probably benign Het
Olfr136 T A 17: 38,335,292 I45N probably damaging Het
Oprd1 T C 4: 132,117,452 T82A probably damaging Het
Orc3 A G 4: 34,595,136 C278R probably damaging Het
Pms1 T C 1: 53,197,072 E683G probably benign Het
Prdm2 A T 4: 143,179,299 Y73N probably damaging Het
Prkaa2 T C 4: 105,075,543 Q36R probably benign Het
Psg22 A G 7: 18,722,966 E258G probably damaging Het
Ptprf T C 4: 118,212,172 D1566G probably damaging Het
Rfwd3 T A 8: 111,273,069 Y759F probably benign Het
Ripor2 A G 13: 24,696,550 D411G probably damaging Het
Sdr42e1 T C 8: 117,662,751 T384A probably benign Het
Sec16a A T 2: 26,421,397 F616I Het
Sipa1l2 T C 8: 125,482,106 D521G possibly damaging Het
Smc1b T A 15: 85,097,542 Q759L probably benign Het
Snph A T 2: 151,600,343 S57R probably damaging Het
Sqor A T 2: 122,787,530 T103S probably benign Het
Srbd1 A G 17: 86,136,321 V159A probably benign Het
Srsf2 A T 11: 116,852,901 V10E probably damaging Het
Swap70 T A 7: 110,264,109 probably null Het
Synm A C 7: 67,733,206 *675G probably null Het
Tek A G 4: 94,811,345 E320G probably benign Het
Tenm3 T C 8: 48,236,183 D2123G probably damaging Het
Tmod4 A G 3: 95,125,863 K56R possibly damaging Het
Top3b G A 16: 16,877,850 probably benign Het
Tssc4 G T 7: 143,070,688 E244D possibly damaging Het
Unc79 A T 12: 103,088,758 M954L possibly damaging Het
Vcpip1 A T 1: 9,746,315 D614E probably benign Het
Vmn1r45 T A 6: 89,933,053 I312L probably benign Het
Vmn1r77 A G 7: 12,041,684 Y129C probably damaging Het
Zer1 A G 2: 30,102,822 L600P probably damaging Het
Zfp266 T C 9: 20,500,936 T114A probably benign Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 133243044 splice site probably benign
IGL01060:Map3k6 APN 4 133247302 splice site probably null
IGL01116:Map3k6 APN 4 133247128 missense probably damaging 0.98
IGL01341:Map3k6 APN 4 133248060 missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 133246621 splice site probably null
IGL03090:Map3k6 APN 4 133243366 missense probably benign 0.05
IGL03096:Map3k6 APN 4 133251345 nonsense probably null
IGL03149:Map3k6 APN 4 133249688 missense probably damaging 1.00
R0110:Map3k6 UTSW 4 133243794 missense probably damaging 1.00
R0142:Map3k6 UTSW 4 133250946 missense probably benign
R0189:Map3k6 UTSW 4 133246941 missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 133252659 missense probably benign 0.23
R0417:Map3k6 UTSW 4 133248082 nonsense probably null
R0595:Map3k6 UTSW 4 133241263 missense probably damaging 0.98
R0597:Map3k6 UTSW 4 133245552 missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 133248126 missense probably damaging 1.00
R1099:Map3k6 UTSW 4 133247128 missense probably damaging 1.00
R1113:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1308:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1607:Map3k6 UTSW 4 133252473 missense probably damaging 1.00
R2217:Map3k6 UTSW 4 133246672 missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 133248396 missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 133246372 missense probably benign 0.21
R3743:Map3k6 UTSW 4 133245073 missense probably benign 0.26
R4244:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 133246333 missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 133243399 missense probably benign 0.00
R4827:Map3k6 UTSW 4 133248849 missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 133251743 missense probably benign 0.00
R5110:Map3k6 UTSW 4 133247548 intron probably benign
R5258:Map3k6 UTSW 4 133247642 missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 133247681 missense probably damaging 0.99
R5642:Map3k6 UTSW 4 133245544 missense probably damaging 0.99
R5648:Map3k6 UTSW 4 133243335 missense probably benign 0.25
R6102:Map3k6 UTSW 4 133247131 critical splice donor site probably null
R6144:Map3k6 UTSW 4 133245675 missense probably damaging 1.00
R6476:Map3k6 UTSW 4 133250086 missense probably damaging 0.98
R6511:Map3k6 UTSW 4 133248078 missense probably damaging 0.98
R6522:Map3k6 UTSW 4 133250024 missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 133250939 nonsense probably null
R6874:Map3k6 UTSW 4 133250656 missense probably benign 0.02
R7069:Map3k6 UTSW 4 133251712 missense probably benign 0.01
R7216:Map3k6 UTSW 4 133246900 missense probably damaging 0.99
R7538:Map3k6 UTSW 4 133251927 missense probably benign
R7569:Map3k6 UTSW 4 133250077 missense probably benign 0.04
Z1088:Map3k6 UTSW 4 133245066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAACTCTAGCGTGCGTGG -3'
(R):5'- CGCCTTTAAGGGACCTCTTTG -3'

Sequencing Primer
(F):5'- CGTGGGTATCACCTAGAATTAGC -3'
(R):5'- ACCCTCTGCCAAAGTGTG -3'
Posted On2019-10-07