Mutagenetix > Incidental Mutations

Incidental Mutation 'R7417:Prdm2'

575374

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7417 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 143179299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 73 (Y73N)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778] [ENSMUST00000134791] [ENSMUST00000154280]

AlphaFold

A2A7B5

Predicted Effect

probably damaging
Transcript: ENSMUST00000105778
AA Change: Y73N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Y73N

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134791

SMART Domains

Protein: ENSMUSP00000116458
Gene: ENSMUSG00000057637

Domain	Start	End	E-Value	Type
SET	29	137	1.35e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154280
AA Change: Y73N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117741
Gene: ENSMUSG00000057637
AA Change: Y73N

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	G	A	17: 48,152,889	T213I	probably damaging	Het
Akr1b7	G	A	6: 34,417,365		probably null	Het
Aldh6a1	T	C	12: 84,441,782	Q110R	probably benign	Het
Alg11	A	T	8: 22,062,028	T63S	probably benign	Het
Ankrd13b	A	G	11: 77,476,194	Y271H	probably damaging	Het
Ano8	T	A	8: 71,480,833	D605V	unknown	Het
Best2	C	T	8: 85,009,666		probably null	Het
Brca1	A	G	11: 101,524,981	S776P	probably damaging	Het
Capn7	T	C	14: 31,370,706	Y737H	probably damaging	Het
Cblc	A	T	7: 19,788,974	S333T	probably benign	Het
Ccm2	T	A	11: 6,593,091	M257K	probably benign	Het
Cd320	T	A	17: 33,847,556	C103*	probably null	Het
Cd53	A	G	3: 106,768,919	F44S	probably benign	Het
Col9a2	G	A	4: 121,054,292	R610H	not run	Het
Cubn	T	C	2: 13,426,967	I1272V	probably benign	Het
Cyp2j7	C	T	4: 96,201,988		probably null	Het
Dmrt2	A	T	19: 25,678,598	R520S	probably benign	Het
Drg2	A	G	11: 60,454,680	M1V	probably null	Het
Ect2	A	G	3: 27,098,419	S908P	probably damaging	Het
Eipr1	A	G	12: 28,866,955	T341A	probably benign	Het
Ell3	A	C	2: 121,440,410	I214R	probably benign	Het
Emsy	A	T	7: 98,615,486	L568Q	probably damaging	Het
Foxd4	T	C	19: 24,900,462	T125A	probably damaging	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Gcsam	C	A	16: 45,619,877	H94Q	probably damaging	Het
Ginm1	T	A	10: 7,774,080	I150F	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Hk2	G	A	6: 82,743,345	A205V	probably damaging	Het
Il3ra	A	T	14: 14,349,345	H147L	probably benign	Het
Map3k6	T	A	4: 133,248,396	S732T	probably benign	Het
Masp2	A	G	4: 148,605,721	E229G	probably benign	Het
Mccc2	A	G	13: 99,971,777		probably null	Het
Mia3	A	G	1: 183,327,653	V359A		Het
Mob1a	A	T	6: 83,332,510	T80S	probably benign	Het
Msantd2	G	A	9: 37,523,294	G478S	probably damaging	Het
Mtf1	A	G	4: 124,825,181	E329G	probably null	Het
Myh9	T	A	15: 77,763,865	K1804*	probably null	Het
Ndst3	A	G	3: 123,671,664	W220R	probably damaging	Het
Nln	A	G	13: 104,036,970	L576P	probably damaging	Het
Nlrc4	A	G	17: 74,446,488	M300T	probably benign	Het
Obscn	G	T	11: 59,129,577	D880E	possibly damaging	Het
Olfr1313	A	C	2: 112,072,100	V161G	probably benign	Het
Olfr136	T	A	17: 38,335,292	I45N	probably damaging	Het
Oprd1	T	C	4: 132,117,452	T82A	probably damaging	Het
Orc3	A	G	4: 34,595,136	C278R	probably damaging	Het
Pde4d	T	A	13: 109,632,788		probably null	Het
Pms1	T	C	1: 53,197,072	E683G	probably benign	Het
Prkaa2	T	C	4: 105,075,543	Q36R	probably benign	Het
Psg22	A	G	7: 18,722,966	E258G	probably damaging	Het
Ptprf	T	C	4: 118,212,172	D1566G	probably damaging	Het
Rfwd3	T	A	8: 111,273,069	Y759F	probably benign	Het
Ripor2	A	G	13: 24,696,550	D411G	probably damaging	Het
Ryr2	A	C	13: 11,556,748		probably null	Het
Sdr42e1	T	C	8: 117,662,751	T384A	probably benign	Het
Sec1	A	T	7: 45,684,725		probably null	Het
Sec16a	A	T	2: 26,421,397	F616I		Het
Sipa1l2	T	C	8: 125,482,106	D521G	possibly damaging	Het
Smc1b	T	A	15: 85,097,542	Q759L	probably benign	Het
Snph	A	T	2: 151,600,343	S57R	probably damaging	Het
Sqor	A	T	2: 122,787,530	T103S	probably benign	Het
Srbd1	A	G	17: 86,136,321	V159A	probably benign	Het
Srsf2	A	T	11: 116,852,901	V10E	probably damaging	Het
Swap70	T	A	7: 110,264,109		probably null	Het
Synm	A	C	7: 67,733,206	*675G	probably null	Het
Tek	A	G	4: 94,811,345	E320G	probably benign	Het
Tenm3	T	C	8: 48,236,183	D2123G	probably damaging	Het
Tmod4	A	G	3: 95,125,863	K56R	possibly damaging	Het
Top3b	G	A	16: 16,877,850		probably benign	Het
Tssc4	G	T	7: 143,070,688	E244D	possibly damaging	Het
Twnk	G	A	19: 45,010,564		probably null	Het
Ube4a	A	C	9: 44,956,713	I45S	probably benign	Het
Unc79	A	T	12: 103,088,758	M954L	possibly damaging	Het
Vcpip1	A	T	1: 9,746,315	D614E	probably benign	Het
Vmn1r45	T	A	6: 89,933,053	I312L	probably benign	Het
Vmn1r77	A	G	7: 12,041,684	Y129C	probably damaging	Het
Wdr63	A	T	3: 146,093,080		probably null	Het
Zer1	A	G	2: 30,102,822	L600P	probably damaging	Het
Zfp266	T	C	9: 20,500,936	T114A	probably benign	Het
Zrsr1	T	C	11: 22,974,662		probably null	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCAGCTTCAAACTACACAG -3'
(R):5'- CCCCTGGAGGACTTTAGTTG -3'

Sequencing Primer
(F):5'- GGCAGCTTCAAACTACACAGACATG -3'
(R):5'- CCCCTGGAGGACTTTAGTTGATTTG -3'

Posted On

2019-10-07