Mutagenetix > Incidental Mutation

Incidental Mutation 'R7417:Brca1'

575399

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7417 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101524981 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 776 (S776P)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

probably damaging
Transcript: ENSMUST00000017290
AA Change: S776P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: S776P

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	G	A	17: 48,152,889	T213I	probably damaging	Het
Akr1b7	G	A	6: 34,417,365		probably null	Het
Aldh6a1	T	C	12: 84,441,782	Q110R	probably benign	Het
Alg11	A	T	8: 22,062,028	T63S	probably benign	Het
Ankrd13b	A	G	11: 77,476,194	Y271H	probably damaging	Het
Ano8	T	A	8: 71,480,833	D605V	unknown	Het
Best2	C	T	8: 85,009,666		probably null	Het
Capn7	T	C	14: 31,370,706	Y737H	probably damaging	Het
Cblc	A	T	7: 19,788,974	S333T	probably benign	Het
Ccm2	T	A	11: 6,593,091	M257K	probably benign	Het
Cd320	T	A	17: 33,847,556	C103*	probably null	Het
Cd53	A	G	3: 106,768,919	F44S	probably benign	Het
Col9a2	G	A	4: 121,054,292	R610H	not run	Het
Cubn	T	C	2: 13,426,967	I1272V	probably benign	Het
Cyp2j7	C	T	4: 96,201,988		probably null	Het
Dmrt2	A	T	19: 25,678,598	R520S	probably benign	Het
Drg2	A	G	11: 60,454,680	M1V	probably null	Het
Ect2	A	G	3: 27,098,419	S908P	probably damaging	Het
Eipr1	A	G	12: 28,866,955	T341A	probably benign	Het
Ell3	A	C	2: 121,440,410	I214R	probably benign	Het
Emsy	A	T	7: 98,615,486	L568Q	probably damaging	Het
Foxd4	T	C	19: 24,900,462	T125A	probably damaging	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Gcsam	C	A	16: 45,619,877	H94Q	probably damaging	Het
Ginm1	T	A	10: 7,774,080	I150F	probably damaging	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Hk2	G	A	6: 82,743,345	A205V	probably damaging	Het
Il3ra	A	T	14: 14,349,345	H147L	probably benign	Het
Map3k6	T	A	4: 133,248,396	S732T	probably benign	Het
Masp2	A	G	4: 148,605,721	E229G	probably benign	Het
Mccc2	A	G	13: 99,971,777		probably null	Het
Mia3	A	G	1: 183,327,653	V359A		Het
Mob1a	A	T	6: 83,332,510	T80S	probably benign	Het
Msantd2	G	A	9: 37,523,294	G478S	probably damaging	Het
Mtf1	A	G	4: 124,825,181	E329G	probably null	Het
Myh9	T	A	15: 77,763,865	K1804*	probably null	Het
Ndst3	A	G	3: 123,671,664	W220R	probably damaging	Het
Nln	A	G	13: 104,036,970	L576P	probably damaging	Het
Nlrc4	A	G	17: 74,446,488	M300T	probably benign	Het
Obscn	G	T	11: 59,129,577	D880E	possibly damaging	Het
Olfr1313	A	C	2: 112,072,100	V161G	probably benign	Het
Olfr136	T	A	17: 38,335,292	I45N	probably damaging	Het
Oprd1	T	C	4: 132,117,452	T82A	probably damaging	Het
Orc3	A	G	4: 34,595,136	C278R	probably damaging	Het
Pde4d	T	A	13: 109,632,788		probably null	Het
Pms1	T	C	1: 53,197,072	E683G	probably benign	Het
Prdm2	A	T	4: 143,179,299	Y73N	probably damaging	Het
Prkaa2	T	C	4: 105,075,543	Q36R	probably benign	Het
Psg22	A	G	7: 18,722,966	E258G	probably damaging	Het
Ptprf	T	C	4: 118,212,172	D1566G	probably damaging	Het
Rfwd3	T	A	8: 111,273,069	Y759F	probably benign	Het
Ripor2	A	G	13: 24,696,550	D411G	probably damaging	Het
Ryr2	A	C	13: 11,556,748		probably null	Het
Sdr42e1	T	C	8: 117,662,751	T384A	probably benign	Het
Sec1	A	T	7: 45,684,725		probably null	Het
Sec16a	A	T	2: 26,421,397	F616I		Het
Sipa1l2	T	C	8: 125,482,106	D521G	possibly damaging	Het
Smc1b	T	A	15: 85,097,542	Q759L	probably benign	Het
Snph	A	T	2: 151,600,343	S57R	probably damaging	Het
Sqor	A	T	2: 122,787,530	T103S	probably benign	Het
Srbd1	A	G	17: 86,136,321	V159A	probably benign	Het
Srsf2	A	T	11: 116,852,901	V10E	probably damaging	Het
Swap70	T	A	7: 110,264,109		probably null	Het
Synm	A	C	7: 67,733,206	*675G	probably null	Het
Tek	A	G	4: 94,811,345	E320G	probably benign	Het
Tenm3	T	C	8: 48,236,183	D2123G	probably damaging	Het
Tmod4	A	G	3: 95,125,863	K56R	possibly damaging	Het
Top3b	G	A	16: 16,877,850		probably benign	Het
Tssc4	G	T	7: 143,070,688	E244D	possibly damaging	Het
Twnk	G	A	19: 45,010,564		probably null	Het
Ube4a	A	C	9: 44,956,713	I45S	probably benign	Het
Unc79	A	T	12: 103,088,758	M954L	possibly damaging	Het
Vcpip1	A	T	1: 9,746,315	D614E	probably benign	Het
Vmn1r45	T	A	6: 89,933,053	I312L	probably benign	Het
Vmn1r77	A	G	7: 12,041,684	Y129C	probably damaging	Het
Wdr63	A	T	3: 146,093,080		probably null	Het
Zer1	A	G	2: 30,102,822	L600P	probably damaging	Het
Zfp266	T	C	9: 20,500,936	T114A	probably benign	Het
Zrsr1	T	C	11: 22,974,662		probably null	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGAGTATCAAGTTCACTGTCTTCC -3'
(R):5'- TCTCAAGGGCCTGTCAATCC -3'

Sequencing Primer
(F):5'- TCTACTTTCTCCTGACTGAGGTTAAG -3'
(R):5'- TGTCAATCCCAGCCCTCAGAG -3'

Posted On

2019-10-07